EMAIL THIS PAGE TO A FRIEND

CCDC94

coiled-coil domain containing 94

57 Gene Product Result for
UniProtKB ID: Q9BW85, O75270, Q9H862, Q9NW16
Gene ID:
Mouse(72886) coiled-coil domain containing 94
Rat(501285) coiled-coil domain containing 94
Zebrafish(393117) coiled-coil domain containing 94
chicken(425754) coiled-coil domain containing 94
cow(514934) coiled-coil domain containing 94
domestic cat(101101289) coiled-coil domain containing 94
dog(611929) coiled-coil domain containing 94
sheep(101112814) coiled-coil domain containing 94
naked mole-rat(101704661) coiled-coil domain containing 94
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_028381 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_028381 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_028381 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_018074 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_018074 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_018074 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_018074 Rosetta Predictions human pricing
NM_001109673 Rosetta Predictions rat pricing
NM_028381 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_018074 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00209080 predicted 979
2 SASI_Hs01_00209083 predicted 949
3 SASI_Hs02_00351219 predicted 615
4 SASI_Hs01_00209084 predicted 962
5 SASI_Hs01_00209087 predicted 1046
6 SASI_Hs01_00209089 predicted 974
7 SASI_Hs02_00351220 predicted 648
8 SASI_Hs02_00351221 predicted 904
9 SASI_Hs02_00351222 predicted 951
10 SASI_Hs02_00351223 predicted 1056
11 SASI_Hs01_00209081 predicted 1169
12 SASI_Hs01_00209082 predicted 1168
13 SASI_Hs01_00209085 predicted 984
14 SASI_Hs01_00209086 predicted 1011
15 SASI_Hs01_00209088 predicted 1174
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001109673 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00250592 predicted 993
2 SASI_Rn02_00250593 predicted 1007
3 SASI_Rn02_00250594 predicted 961
4 SASI_Rn02_00250595 predicted 1472
5 SASI_Rn02_00250596 predicted 1035
6 SASI_Rn02_00250597 predicted 1355
7 SASI_Rn02_00250598 predicted 1216
8 SASI_Rn02_00250599 predicted 990
9 SASI_Rn02_00250600 predicted 1375
10 SASI_Rn02_00250601 predicted 1264
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_028381 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00333754 predicted 826
2 SASI_Mm02_00333755 predicted 806
3 SASI_Mm02_00333756 predicted 802
4 SASI_Mm01_00193031 predicted 241
5 SASI_Mm01_00193032 predicted 249
6 SASI_Mm01_00193033 predicted 242
7 SASI_Mm02_00333757 predicted 257
8 SASI_Mm02_00333758 predicted 255
9 SASI_Mm01_00193036 predicted 659
10 SASI_Mm02_00333759 predicted 305
11 SASI_Mm01_00193034 predicted 759
12 SASI_Mm01_00193035 predicted 252
13 SASI_Mm01_00193037 predicted 1406
14 SASI_Mm01_00193038 predicted 195
15 SASI_Mm01_00193039 predicted 1462
16 SASI_Mm01_00193040 predicted 1035
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_028381
VALIDATED
CCDC94 MISSION shRNA Bacterial Glycerol Stock
coiled-coil domain containing 94
Mouse
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000182932    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028381.1-840s1c1
Sequence:CCGGCCAAAGAAGGTAAAGACAGAACTCGAGTTCTGTCTTTACCTTCTTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000195854    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028381.1-275s1c1
Sequence:CCGGCCTGCCAATCTTCCGATTCTACTCGAGTAGAATCGGAAGATTGGCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000184753    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.52 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028381.1-1042s1c1
Sequence:CCGGCCCAAGAAATGAGGAGGAGATCTCGAGATCTCCTCCTCATTTCTTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000184222    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028381.1-527s1c1
Sequence:CCGGGCAAGAGCTGAAAGACCTGAACTCGAGTTCAGGTCTTTCAGCTCTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_028381
VALIDATED
CCDC94 MISSION shRNA shRNA Plasmid DNA
coiled-coil domain containing 94
Mouse
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000182932    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028381.1-840s1c1
Sequence:CCGGCCAAAGAAGGTAAAGACAGAACTCGAGTTCTGTCTTTACCTTCTTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000195854    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028381.1-275s1c1
Sequence:CCGGCCTGCCAATCTTCCGATTCTACTCGAGTAGAATCGGAAGATTGGCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000184753    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.52 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028381.1-1042s1c1
Sequence:CCGGCCCAAGAAATGAGGAGGAGATCTCGAGATCTCCTCCTCATTTCTTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000184222    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028381.1-527s1c1
Sequence:CCGGGCAAGAGCTGAAAGACCTGAACTCGAGTTCAGGTCTTTCAGCTCTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_028381
VALIDATED
CCDC94 MISSION shRNA Lentiviral Transduction Particles
coiled-coil domain containing 94
Mouse
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000182932    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028381.1-840s1c1
Sequence:CCGGCCAAAGAAGGTAAAGACAGAACTCGAGTTCTGTCTTTACCTTCTTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000195854    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028381.1-275s1c1
Sequence:CCGGCCTGCCAATCTTCCGATTCTACTCGAGTAGAATCGGAAGATTGGCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000184753    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.52 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028381.1-1042s1c1
Sequence:CCGGCCCAAGAAATGAGGAGGAGATCTCGAGATCTCCTCCTCATTTCTTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000184222    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028381.1-527s1c1
Sequence:CCGGGCAAGAGCTGAAAGACCTGAACTCGAGTTCAGGTCTTTCAGCTCTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_018074
VALIDATED
CCDC94 MISSION shRNA Bacterial Glycerol Stock
coiled-coil domain containing 94
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000165578    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_018074.3-331s1c1
Sequence:CCGGGCAGAGATCACCTTCAAGACACTCGAGTGTCTTGAAGGTGATCTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000165395    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_018074.3-190s1c1
Sequence:CCGGCCCTTCAACATGAGGTGTAAGCTCGAGCTTACACCTCATGTTGAAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000165513    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.61 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_018074.3-1320s1c1
Sequence:CCGGGCAGCTTCCAACACTACTTCACTCGAGTGAAGTAGTGTTGGAAGCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000165185    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_018074.3-1318s1c1
Sequence:CCGGGAGCAGCTTCCAACACTACTTCTCGAGAAGTAGTGTTGGAAGCTGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000164715    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018074.3-116s1c1
Sequence:CCGGCGGACTTTGACCCATCAAAGACTCGAGTCTTTGATGGGTCAAAGTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000165186    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_018074.3-204s1c1
Sequence:CCGGGTGTAAGACGTGCGGAGAATACTCGAGTATTCTCCGCACGTCTTACACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000165296    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_018074.3-206s1c1
Sequence:CCGGGTAAGACGTGCGGAGAATACACTCGAGTGTATTCTCCGCACGTCTTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000162914    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_018074.3-213s1c1
Sequence:CCGGGTGCGGAGAATACATCTACAACTCGAGTTGTAGATGTATTCTCCGCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000161525    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_018074.3-237s1c1
Sequence:CCGGGAAGAAATTCAATGCTCGGAACTCGAGTTCCGAGCATTGAATTTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_018074
VALIDATED
CCDC94 MISSION shRNA shRNA Plasmid DNA
coiled-coil domain containing 94
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000165578    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_018074.3-331s1c1
Sequence:CCGGGCAGAGATCACCTTCAAGACACTCGAGTGTCTTGAAGGTGATCTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000165395    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_018074.3-190s1c1
Sequence:CCGGCCCTTCAACATGAGGTGTAAGCTCGAGCTTACACCTCATGTTGAAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000165513    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.61 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_018074.3-1320s1c1
Sequence:CCGGGCAGCTTCCAACACTACTTCACTCGAGTGAAGTAGTGTTGGAAGCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000165185    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_018074.3-1318s1c1
Sequence:CCGGGAGCAGCTTCCAACACTACTTCTCGAGAAGTAGTGTTGGAAGCTGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000164715    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018074.3-116s1c1
Sequence:CCGGCGGACTTTGACCCATCAAAGACTCGAGTCTTTGATGGGTCAAAGTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000165186    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_018074.3-204s1c1
Sequence:CCGGGTGTAAGACGTGCGGAGAATACTCGAGTATTCTCCGCACGTCTTACACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000165296    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_018074.3-206s1c1
Sequence:CCGGGTAAGACGTGCGGAGAATACACTCGAGTGTATTCTCCGCACGTCTTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000162914    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_018074.3-213s1c1
Sequence:CCGGGTGCGGAGAATACATCTACAACTCGAGTTGTAGATGTATTCTCCGCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000161525    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_018074.3-237s1c1
Sequence:CCGGGAAGAAATTCAATGCTCGGAACTCGAGTTCCGAGCATTGAATTTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_018074
VALIDATED
CCDC94 MISSION shRNA Lentiviral Transduction Particles
coiled-coil domain containing 94
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000165578    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_018074.3-331s1c1
Sequence:CCGGGCAGAGATCACCTTCAAGACACTCGAGTGTCTTGAAGGTGATCTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000165395    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_018074.3-190s1c1
Sequence:CCGGCCCTTCAACATGAGGTGTAAGCTCGAGCTTACACCTCATGTTGAAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000165513    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.61 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_018074.3-1320s1c1
Sequence:CCGGGCAGCTTCCAACACTACTTCACTCGAGTGAAGTAGTGTTGGAAGCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000165185    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_018074.3-1318s1c1
Sequence:CCGGGAGCAGCTTCCAACACTACTTCTCGAGAAGTAGTGTTGGAAGCTGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000164715    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018074.3-116s1c1
Sequence:CCGGCGGACTTTGACCCATCAAAGACTCGAGTCTTTGATGGGTCAAAGTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000165186    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_018074.3-204s1c1
Sequence:CCGGGTGTAAGACGTGCGGAGAATACTCGAGTATTCTCCGCACGTCTTACACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000165296    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_018074.3-206s1c1
Sequence:CCGGGTAAGACGTGCGGAGAATACACTCGAGTGTATTCTCCGCACGTCTTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000162914    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_018074.3-213s1c1
Sequence:CCGGGTGCGGAGAATACATCTACAACTCGAGTTGTAGATGTATTCTCCGCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000161525    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_018074.3-237s1c1
Sequence:CCGGGAAGAAATTCAATGCTCGGAACTCGAGTTCCGAGCATTGAATTTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks