EMAIL THIS PAGE TO A FRIEND

CCDC96

coiled-coil domain containing 96

56 Gene Product Result for
UniProtKB ID: Q2M329, Q8N2I7
Gene ID:
Mouse(66717) coiled-coil domain containing 96
Rat(289716) coiled-coil domain containing 96
domestic guinea pig(100734018) coiled-coil domain containing 96
naked mole-rat(101715901) coiled-coil domain containing 96
sheep(101108917) coiled-coil domain containing 96
Zebrafish(559167) coiled-coil domain containing 96
dog(488782) coiled-coil domain containing 96
cow(100125235) coiled-coil domain containing 96
domestic cat(101090514) coiled-coil domain containing 96
chicken(100859647) coiled-coil domain containing 96
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_153376 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_153376 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_153376 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_025725 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_025725 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_025725 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_153376 Rosetta Predictions human pricing
XM_001063560 Rosetta Predictions rat pricing
XM_223518 Rosetta Predictions rat pricing
NM_025725 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_153376 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00096074 predicted 949
2 SASI_Hs01_00096075 predicted 1298
3 SASI_Hs01_00096076 predicted 1382
4 SASI_Hs01_00096077 predicted 1329
5 SASI_Hs02_00367266 predicted 1881
6 SASI_Hs01_00096079 predicted 1420
7 SASI_Hs01_00096080 predicted 1037
8 SASI_Hs02_00367267 predicted 1616
9 SASI_Hs02_00367268 predicted 1719
10 SASI_Hs02_00367269 predicted 1822
11 SASI_Hs01_00096078 predicted 1466
12 SASI_Hs01_00096081 predicted 1307
13 SASI_Hs01_00096082 predicted 1488
14 SASI_Hs01_00096083 predicted 1315
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001063560 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00307594 predicted 1351
2 SASI_Rn02_00307595 predicted 1420
3 SASI_Rn02_00307596 predicted 1370
4 SASI_Rn02_00307597 predicted 1521
5 SASI_Rn02_00307598 predicted 1750
6 SASI_Rn02_00307599 predicted 998
7 SASI_Rn02_00307600 predicted 1019
8 SASI_Rn02_00307601 predicted 1401
9 SASI_Rn02_00307602 predicted 1578
10 SASI_Rn02_00307603 predicted 1857
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_223518 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00381457 predicted 1346
2 SASI_Rn02_00381458 predicted 1418
3 SASI_Rn02_00381459 predicted 1366
4 SASI_Rn02_00381460 predicted 1742
5 SASI_Rn02_00381461 predicted 991
6 SASI_Rn02_00381462 predicted 828
7 SASI_Rn02_00381463 predicted 1019
8 SASI_Rn02_00381464 predicted 1393
9 SASI_Rn02_00381465 predicted 818
10 SASI_Rn02_00381466 predicted 1854
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_025725 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00148565 predicted 1864
2 SASI_Mm01_00148566 predicted 1464
3 SASI_Mm01_00148567 predicted 1419
4 SASI_Mm01_00148568 predicted 870
5 SASI_Mm01_00148569 predicted 1392
6 SASI_Mm01_00148570 predicted 866
7 SASI_Mm01_00148571 predicted 877
8 SASI_Mm01_00148572 predicted 1878
9 SASI_Mm01_00148573 predicted 2097
10 SASI_Mm01_00148574 predicted 1861
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_153376
CCDC96 MISSION shRNA Bacterial Glycerol Stock
coiled-coil domain containing 96
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000136032    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153376.1-1268s1c1
Sequence:CCGGGAGGAACGAAATGAGGAACTTCTCGAGAAGTTCCTCATTTCGTTCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000135004    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153376.1-1311s1c1
Sequence:CCGGCCAACAGTGTGCAAGTAATAACTCGAGTTATTACTTGCACACTGTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000135302    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153376.1-1229s1c1
Sequence:CCGGCAGCTGAAGATTGAGAACCAACTCGAGTTGGTTCTCAATCTTCAGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000134572    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153376.1-1243s1c1
Sequence:CCGGGAACCAAACCTTCAATGAGAACTCGAGTTCTCATTGAAGGTTTGGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000134237    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153376.1-1234s1c1
Sequence:CCGGGAAGATTGAGAACCAAACCTTCTCGAGAAGGTTTGGTTCTCAATCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000134745    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153376.1-1237s1c1
Sequence:CCGGGATTGAGAACCAAACCTTCAACTCGAGTTGAAGGTTTGGTTCTCAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000434248    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_153376.2-1826s21c1
Sequence:CCGGATTTGGGACGGGACTCTATTTCTCGAGAAATAGAGTCCCGTCCCAAATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000414105    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_153376.2-1773s21c1
Sequence:CCGGGACGTGCTGTCCTGCTTTATTCTCGAGAATAAAGCAGGACAGCACGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_153376
CCDC96 MISSION shRNA shRNA Plasmid DNA
coiled-coil domain containing 96
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000136032    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153376.1-1268s1c1
Sequence:CCGGGAGGAACGAAATGAGGAACTTCTCGAGAAGTTCCTCATTTCGTTCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000135004    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153376.1-1311s1c1
Sequence:CCGGCCAACAGTGTGCAAGTAATAACTCGAGTTATTACTTGCACACTGTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000135302    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153376.1-1229s1c1
Sequence:CCGGCAGCTGAAGATTGAGAACCAACTCGAGTTGGTTCTCAATCTTCAGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000134572    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153376.1-1243s1c1
Sequence:CCGGGAACCAAACCTTCAATGAGAACTCGAGTTCTCATTGAAGGTTTGGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000134237    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153376.1-1234s1c1
Sequence:CCGGGAAGATTGAGAACCAAACCTTCTCGAGAAGGTTTGGTTCTCAATCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000134745    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153376.1-1237s1c1
Sequence:CCGGGATTGAGAACCAAACCTTCAACTCGAGTTGAAGGTTTGGTTCTCAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000434248    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_153376.2-1826s21c1
Sequence:CCGGATTTGGGACGGGACTCTATTTCTCGAGAAATAGAGTCCCGTCCCAAATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000414105    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_153376.2-1773s21c1
Sequence:CCGGGACGTGCTGTCCTGCTTTATTCTCGAGAATAAAGCAGGACAGCACGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_153376
CCDC96 MISSION shRNA Lentiviral Transduction Particles
coiled-coil domain containing 96
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000136032    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153376.1-1268s1c1
Sequence:CCGGGAGGAACGAAATGAGGAACTTCTCGAGAAGTTCCTCATTTCGTTCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000135004    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153376.1-1311s1c1
Sequence:CCGGCCAACAGTGTGCAAGTAATAACTCGAGTTATTACTTGCACACTGTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000135302    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153376.1-1229s1c1
Sequence:CCGGCAGCTGAAGATTGAGAACCAACTCGAGTTGGTTCTCAATCTTCAGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000134572    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153376.1-1243s1c1
Sequence:CCGGGAACCAAACCTTCAATGAGAACTCGAGTTCTCATTGAAGGTTTGGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000134237    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153376.1-1234s1c1
Sequence:CCGGGAAGATTGAGAACCAAACCTTCTCGAGAAGGTTTGGTTCTCAATCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000134745    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153376.1-1237s1c1
Sequence:CCGGGATTGAGAACCAAACCTTCAACTCGAGTTGAAGGTTTGGTTCTCAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000434248    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_153376.2-1826s21c1
Sequence:CCGGATTTGGGACGGGACTCTATTTCTCGAGAAATAGAGTCCCGTCCCAAATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000414105    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_153376.2-1773s21c1
Sequence:CCGGGACGTGCTGTCCTGCTTTATTCTCGAGAATAAAGCAGGACAGCACGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_025725
CCDC96 MISSION shRNA Bacterial Glycerol Stock
coiled-coil domain containing 96
Mouse
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000196112    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025725.2-1459s1c1
Sequence:CCGGGACCAGCAACGTGCAGATTATCTCGAGATAATCTGCACGTTGCTGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000184570    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025725.2-1535s1c1
Sequence:CCGGGCACAACTTTCGGAAGTGGATCTCGAGATCCACTTCCGAAAGTTGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000184375    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025725.2-992s1c1
Sequence:CCGGGAGCAAGCATACTTGCGCTATCTCGAGATAGCGCAAGTATGCTTGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000183418    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_025725.2-2580s1c1
Sequence:CCGGCCGTACTTTGTTTGCTGAAATCTCGAGATTTCAGCAAACAAAGTACGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000179342    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025725.2-1471s1c1
Sequence:CCGGGCAGATTATAACGCACGTGAACTCGAGTTCACGTGCGTTATAATCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000216752    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025725.2-1409s1c1
Sequence:CCGGGAGAAAGTAGAGGAACGAAACCTCGAGGTTTCGTTCCTCTACTTTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_025725
CCDC96 MISSION shRNA shRNA Plasmid DNA
coiled-coil domain containing 96
Mouse
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000196112    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025725.2-1459s1c1
Sequence:CCGGGACCAGCAACGTGCAGATTATCTCGAGATAATCTGCACGTTGCTGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000184570    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025725.2-1535s1c1
Sequence:CCGGGCACAACTTTCGGAAGTGGATCTCGAGATCCACTTCCGAAAGTTGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000184375    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025725.2-992s1c1
Sequence:CCGGGAGCAAGCATACTTGCGCTATCTCGAGATAGCGCAAGTATGCTTGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000183418    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_025725.2-2580s1c1
Sequence:CCGGCCGTACTTTGTTTGCTGAAATCTCGAGATTTCAGCAAACAAAGTACGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000179342    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025725.2-1471s1c1
Sequence:CCGGGCAGATTATAACGCACGTGAACTCGAGTTCACGTGCGTTATAATCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000216752    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025725.2-1409s1c1
Sequence:CCGGGAGAAAGTAGAGGAACGAAACCTCGAGGTTTCGTTCCTCTACTTTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_025725
CCDC96 MISSION shRNA Lentiviral Transduction Particles
coiled-coil domain containing 96
Mouse
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000196112    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025725.2-1459s1c1
Sequence:CCGGGACCAGCAACGTGCAGATTATCTCGAGATAATCTGCACGTTGCTGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000184570    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025725.2-1535s1c1
Sequence:CCGGGCACAACTTTCGGAAGTGGATCTCGAGATCCACTTCCGAAAGTTGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000184375    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025725.2-992s1c1
Sequence:CCGGGAGCAAGCATACTTGCGCTATCTCGAGATAGCGCAAGTATGCTTGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000183418    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_025725.2-2580s1c1
Sequence:CCGGCCGTACTTTGTTTGCTGAAATCTCGAGATTTCAGCAAACAAAGTACGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000179342    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025725.2-1471s1c1
Sequence:CCGGGCAGATTATAACGCACGTGAACTCGAGTTCACGTGCGTTATAATCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000216752    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025725.2-1409s1c1
Sequence:CCGGGAGAAAGTAGAGGAACGAAACCTCGAGGTTTCGTTCCTCTACTTTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks