EMAIL THIS PAGE TO A FRIEND

CCDC9

coiled-coil domain containing 9

38 Gene Product Result for
UniProtKB ID: Q9Y3X0
Gene ID:
Mouse(243846) coiled-coil domain containing 9
domestic guinea pig(100727922) coiled-coil domain containing 9
naked mole-rat(101713927) coiled-coil domain containing 9
Zebrafish(550140) coiled-coil domain containing 9
cow(617257) coiled-coil domain containing 9
domestic cat(101098837) coiled-coil domain containing 9
dog(100684784) coiled-coil domain containing 9
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_015603 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_015603 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_015603 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_172297 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_172297 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_172297 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_015603 Rosetta Predictions human pricing
NM_172297 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_015603 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00178635 predicted 574
2 SASI_Hs01_00178636 predicted 1028
3 SASI_Hs01_00178637 predicted 575
4 SASI_Hs01_00178638 predicted 1042
5 SASI_Hs01_00178639 predicted 663
6 SASI_Hs01_00178640 predicted 266
7 SASI_Hs01_00178641 predicted 889
8 SASI_Hs02_00348188 predicted 247
9 SASI_Hs01_00178643 predicted 305
10 SASI_Hs02_00348189 predicted 589
11 SASI_Hs01_00178642 predicted 587
12 SASI_Hs01_00178644 predicted 892
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_172297 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00050699 predicted 902
2 SASI_Mm01_00050700 predicted 263
3 SASI_Mm01_00050701 predicted 1033
4 SASI_Mm01_00050702 predicted 959
5 SASI_Mm01_00050703 predicted 937
6 SASI_Mm01_00050704 predicted 977
7 SASI_Mm01_00050705 predicted 962
8 SASI_Mm01_00050706 predicted 1081
9 SASI_Mm01_00050707 predicted 1149
10 SASI_Mm01_00050708 predicted 1107
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_015603
VALIDATED
CCDC9 MISSION shRNA Bacterial Glycerol Stock
coiled-coil domain containing 9
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000257021    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_015603.2-645s21c1
Sequence:CCGGCTCAATCTCTGACCGTAAATCCTCGAGGATTTACGGTCAGAGATTGAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000244794    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015603.2-1136s21c1
Sequence:CCGGATGAACCATCCCACCGCTATGCTCGAGCATAGCGGTGGGATGGTTCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000244793    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_015603.2-719s21c1
Sequence:CCGGTGGAGAAGATCGCCGAGTATGCTCGAGCATACTCGGCGATCTTCTCCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000244792    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_015603.2-320s21c1
Sequence:CCGGTTGAGGAAGACCGTAAGAAAGCTCGAGCTTTCTTACGGTCTTCCTCAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000244791    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_015603.2-1469s21c1
Sequence:CCGGATGAAGAATGGGAGGACATAACTCGAGTTATGTCCTCCCATTCTTCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000167446    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015603.1-629s1c1
Sequence:CCGGGCAGAACATTGAGAAGATGAACTCGAGTTCATCTTCTCAATGTTCTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000166878    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015603.1-630s1c1
Sequence:CCGGCAGAACATTGAGAAGATGAATCTCGAGATTCATCTTCTCAATGTTCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000172655    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015603.1-1034s1c1
Sequence:CCGGGAAGACCGATGGGATGTTCAACTCGAGTTGAACATCCCATCGGTCTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_015603
VALIDATED
CCDC9 MISSION shRNA shRNA Plasmid DNA
coiled-coil domain containing 9
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000257021    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_015603.2-645s21c1
Sequence:CCGGCTCAATCTCTGACCGTAAATCCTCGAGGATTTACGGTCAGAGATTGAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000244794    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015603.2-1136s21c1
Sequence:CCGGATGAACCATCCCACCGCTATGCTCGAGCATAGCGGTGGGATGGTTCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000244793    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_015603.2-719s21c1
Sequence:CCGGTGGAGAAGATCGCCGAGTATGCTCGAGCATACTCGGCGATCTTCTCCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000244792    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_015603.2-320s21c1
Sequence:CCGGTTGAGGAAGACCGTAAGAAAGCTCGAGCTTTCTTACGGTCTTCCTCAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000244791    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_015603.2-1469s21c1
Sequence:CCGGATGAAGAATGGGAGGACATAACTCGAGTTATGTCCTCCCATTCTTCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000167446    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015603.1-629s1c1
Sequence:CCGGGCAGAACATTGAGAAGATGAACTCGAGTTCATCTTCTCAATGTTCTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000166878    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015603.1-630s1c1
Sequence:CCGGCAGAACATTGAGAAGATGAATCTCGAGATTCATCTTCTCAATGTTCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000172655    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015603.1-1034s1c1
Sequence:CCGGGAAGACCGATGGGATGTTCAACTCGAGTTGAACATCCCATCGGTCTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_015603
VALIDATED
CCDC9 MISSION shRNA Lentiviral Transduction Particles
coiled-coil domain containing 9
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000257021    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_015603.2-645s21c1
Sequence:CCGGCTCAATCTCTGACCGTAAATCCTCGAGGATTTACGGTCAGAGATTGAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000244794    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015603.2-1136s21c1
Sequence:CCGGATGAACCATCCCACCGCTATGCTCGAGCATAGCGGTGGGATGGTTCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000244793    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_015603.2-719s21c1
Sequence:CCGGTGGAGAAGATCGCCGAGTATGCTCGAGCATACTCGGCGATCTTCTCCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000244792    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_015603.2-320s21c1
Sequence:CCGGTTGAGGAAGACCGTAAGAAAGCTCGAGCTTTCTTACGGTCTTCCTCAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000244791    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_015603.2-1469s21c1
Sequence:CCGGATGAAGAATGGGAGGACATAACTCGAGTTATGTCCTCCCATTCTTCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000167446    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015603.1-629s1c1
Sequence:CCGGGCAGAACATTGAGAAGATGAACTCGAGTTCATCTTCTCAATGTTCTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000166878    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015603.1-630s1c1
Sequence:CCGGCAGAACATTGAGAAGATGAATCTCGAGATTCATCTTCTCAATGTTCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000172655    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015603.1-1034s1c1
Sequence:CCGGGAAGACCGATGGGATGTTCAACTCGAGTTGAACATCCCATCGGTCTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_172297
VALIDATED
CCDC9 MISSION shRNA Bacterial Glycerol Stock
coiled-coil domain containing 9
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000250762    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_172297.1-1293s21c1
Sequence:CCGGCGAGTCCTCTCAGTCCATATCCTCGAGGATATGGACTGAGAGGACTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000250763    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_172297.1-668s21c1
Sequence:CCGGTGGAGAAGATTGCCGAATATGCTCGAGCATATTCGGCAATCTTCTCCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000250764    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_172297.1-1234s21c1
Sequence:CCGGGCCTATAGTGACCACGATAATCTCGAGATTATCGTGGTCACTATAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000250761    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_172297.1-1837s21c1
Sequence:CCGGCTGTGCCCACACCTCCTTCAACTCGAGTTGAAGGAGGTGTGGGCACAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000250760    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_172297.1-1452s21c1
Sequence:CCGGGGACGTGAGTGAAGATGTTACCTCGAGGTAACATCTTCACTCACGTCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000193716    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_172297.1-636s1c1
Sequence:CCGGCAGGCAGAATATCGAGAAGATCTCGAGATCTTCTCGATATTCTGCCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000173409    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_172297.1-1372s1c1
Sequence:CCGGGAGGAAGATGGTGAGGAAGATCTCGAGATCTTCCTCACCATCTTCCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_172297
VALIDATED
CCDC9 MISSION shRNA shRNA Plasmid DNA
coiled-coil domain containing 9
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000250762    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_172297.1-1293s21c1
Sequence:CCGGCGAGTCCTCTCAGTCCATATCCTCGAGGATATGGACTGAGAGGACTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000250763    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_172297.1-668s21c1
Sequence:CCGGTGGAGAAGATTGCCGAATATGCTCGAGCATATTCGGCAATCTTCTCCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000250764    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_172297.1-1234s21c1
Sequence:CCGGGCCTATAGTGACCACGATAATCTCGAGATTATCGTGGTCACTATAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000250761    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_172297.1-1837s21c1
Sequence:CCGGCTGTGCCCACACCTCCTTCAACTCGAGTTGAAGGAGGTGTGGGCACAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000250760    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_172297.1-1452s21c1
Sequence:CCGGGGACGTGAGTGAAGATGTTACCTCGAGGTAACATCTTCACTCACGTCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000193716    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_172297.1-636s1c1
Sequence:CCGGCAGGCAGAATATCGAGAAGATCTCGAGATCTTCTCGATATTCTGCCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000173409    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_172297.1-1372s1c1
Sequence:CCGGGAGGAAGATGGTGAGGAAGATCTCGAGATCTTCCTCACCATCTTCCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_172297
VALIDATED
CCDC9 MISSION shRNA Lentiviral Transduction Particles
coiled-coil domain containing 9
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000250762    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_172297.1-1293s21c1
Sequence:CCGGCGAGTCCTCTCAGTCCATATCCTCGAGGATATGGACTGAGAGGACTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000250763    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_172297.1-668s21c1
Sequence:CCGGTGGAGAAGATTGCCGAATATGCTCGAGCATATTCGGCAATCTTCTCCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000250764    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_172297.1-1234s21c1
Sequence:CCGGGCCTATAGTGACCACGATAATCTCGAGATTATCGTGGTCACTATAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000250761    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_172297.1-1837s21c1
Sequence:CCGGCTGTGCCCACACCTCCTTCAACTCGAGTTGAAGGAGGTGTGGGCACAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000250760    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_172297.1-1452s21c1
Sequence:CCGGGGACGTGAGTGAAGATGTTACCTCGAGGTAACATCTTCACTCACGTCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000193716    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_172297.1-636s1c1
Sequence:CCGGCAGGCAGAATATCGAGAAGATCTCGAGATCTTCTCGATATTCTGCCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000173409    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_172297.1-1372s1c1
Sequence:CCGGGAGGAAGATGGTGAGGAAGATCTCGAGATCTTCCTCACCATCTTCCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)