EMAIL THIS PAGE TO A FRIEND

CCER1

coiled-coil glutamate-rich protein 1

133 Gene Product Result for
Synonyms: C12orf12
UniProtKB ID: Q8TC90, Q8TC47
Gene ID:
Mouse(66716) coiled coil glutamate rich protein 1
Rat(500825) coiled-coil glutamate-rich protein 1
domestic cat(101088256) coiled-coil glutamate-rich protein 1
dog(100684333) coiled-coil glutamate-rich protein 1
cow(615630) coiled-coil glutamate-rich protein 1
domestic guinea pig(100728358) coiled-coil glutamate-rich protein 1
naked mole-rat(101714959) coiled-coil glutamate-rich protein 1
sheep(101112210) coiled-coil glutamate-rich protein 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_152638 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_152638 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_152638 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_025724 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_025724 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_025724 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_152638 Rosetta Predictions human pricing
NM_001025052 Rosetta Predictions rat pricing
NM_025724 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_152638 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00106716 predicted 992
2 SASI_Hs01_00106717 predicted 1861
3 SASI_Hs01_00106718 predicted 2060
4 SASI_Hs02_00366525 predicted 1766
5 SASI_Hs01_00106719 predicted 1680
6 SASI_Hs01_00106720 predicted 2086
7 SASI_Hs01_00106722 predicted 2030
8 SASI_Hs01_00106724 predicted 1681
9 SASI_Hs01_00106725 predicted 986
10 SASI_Hs02_00366526 predicted 1030
11 SASI_Hs01_00106721 predicted 2090
12 SASI_Hs01_00106723 predicted 1704
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001025052 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00109124 predicted 930
2 SASI_Rn01_00109125 predicted 1099
3 SASI_Rn01_00109126 predicted 914
4 SASI_Rn01_00109127 predicted 1417
5 SASI_Rn01_00109128 predicted 507
6 SASI_Rn01_00109129 predicted 554
7 SASI_Rn01_00109130 predicted 1274
8 SASI_Rn01_00109132 predicted 707
9 SASI_Rn01_00109133 predicted 1002
10 SASI_Rn02_00202984 predicted 855
11 SASI_Rn01_00109131 predicted 1238
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_025724 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00114501 predicted 743
2 SASI_Mm01_00114502 predicted 738
3 SASI_Mm01_00114503 predicted 695
4 SASI_Mm01_00114504 predicted 973
5 SASI_Mm01_00114505 predicted 609
6 SASI_Mm01_00114506 predicted 897
7 SASI_Mm01_00114507 predicted 1012
8 SASI_Mm01_00114508 predicted 951
9 SASI_Mm01_00114509 predicted 727
10 SASI_Mm02_00328907 predicted 895
11 SASI_Mm01_00114510 predicted 913
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_152638
CCER1 MISSION shRNA Bacterial Glycerol Stock
coiled-coil glutamate-rich protein 1
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000166988    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_152638.2-2752s1c1
Sequence:CCGGCCATAGCATATTTCCAGAATACTCGAGTATTCTGGAAATATGCTATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000172593    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152638.2-575s1c1
Sequence:CCGGGTACAATAGACCGCACCGATACTCGAGTATCGGTGCGGTCTATTGTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000168854    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_152638.2-2014s1c1
Sequence:CCGGGCCACTTAATGAGCTTGGAATCTCGAGATTCCAAGCTCATTAAGTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000172671    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152638.2-1172s1c1
Sequence:CCGGGCAGGAAACTCTGTATGGCTTCTCGAGAAGCCATACAGAGTTTCCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000173079    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152638.2-1589s1c1
Sequence:CCGGCCCAGAGCAGATAATTCCCAACTCGAGTTGGGAATTATCTGCTCTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000429711    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_152638.2-1771s21c1
Sequence:CCGGCACCTTCTTTGGCCATTATAACTCGAGTTATAATGGCCAAAGAAGGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000412428    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_152638.2-2064s21c1
Sequence:CCGGGCACATTCTAACGCTACTAAACTCGAGTTTAGTAGCGTTAGAATGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000416843    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152638.2-1515s21c1
Sequence:CCGGCTGGAAATGCCTTTATCAATCCTCGAGGATTGATAAAGGCATTTCCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_152638
CCER1 MISSION shRNA shRNA Plasmid DNA
coiled-coil glutamate-rich protein 1
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000166988    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_152638.2-2752s1c1
Sequence:CCGGCCATAGCATATTTCCAGAATACTCGAGTATTCTGGAAATATGCTATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000172593    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152638.2-575s1c1
Sequence:CCGGGTACAATAGACCGCACCGATACTCGAGTATCGGTGCGGTCTATTGTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000168854    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_152638.2-2014s1c1
Sequence:CCGGGCCACTTAATGAGCTTGGAATCTCGAGATTCCAAGCTCATTAAGTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000172671    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152638.2-1172s1c1
Sequence:CCGGGCAGGAAACTCTGTATGGCTTCTCGAGAAGCCATACAGAGTTTCCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000173079    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152638.2-1589s1c1
Sequence:CCGGCCCAGAGCAGATAATTCCCAACTCGAGTTGGGAATTATCTGCTCTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000429711    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_152638.2-1771s21c1
Sequence:CCGGCACCTTCTTTGGCCATTATAACTCGAGTTATAATGGCCAAAGAAGGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000412428    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_152638.2-2064s21c1
Sequence:CCGGGCACATTCTAACGCTACTAAACTCGAGTTTAGTAGCGTTAGAATGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000416843    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152638.2-1515s21c1
Sequence:CCGGCTGGAAATGCCTTTATCAATCCTCGAGGATTGATAAAGGCATTTCCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_152638
CCER1 MISSION shRNA Lentiviral Transduction Particles
coiled-coil glutamate-rich protein 1
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000166988    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_152638.2-2752s1c1
Sequence:CCGGCCATAGCATATTTCCAGAATACTCGAGTATTCTGGAAATATGCTATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000172593    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152638.2-575s1c1
Sequence:CCGGGTACAATAGACCGCACCGATACTCGAGTATCGGTGCGGTCTATTGTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000168854    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_152638.2-2014s1c1
Sequence:CCGGGCCACTTAATGAGCTTGGAATCTCGAGATTCCAAGCTCATTAAGTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000172671    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152638.2-1172s1c1
Sequence:CCGGGCAGGAAACTCTGTATGGCTTCTCGAGAAGCCATACAGAGTTTCCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000173079    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152638.2-1589s1c1
Sequence:CCGGCCCAGAGCAGATAATTCCCAACTCGAGTTGGGAATTATCTGCTCTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000429711    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_152638.2-1771s21c1
Sequence:CCGGCACCTTCTTTGGCCATTATAACTCGAGTTATAATGGCCAAAGAAGGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000412428    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_152638.2-2064s21c1
Sequence:CCGGGCACATTCTAACGCTACTAAACTCGAGTTTAGTAGCGTTAGAATGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000416843    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152638.2-1515s21c1
Sequence:CCGGCTGGAAATGCCTTTATCAATCCTCGAGGATTGATAAAGGCATTTCCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_025724
CCER1 MISSION shRNA Bacterial Glycerol Stock
coiled-coil glutamate-rich protein 1
Mouse
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000181438    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025724.1-1130s1c1
Sequence:CCGGCGTCGAAGAAGATTCGCAGTTCTCGAGAACTGCGAATCTTCTTCGACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000178579    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025724.1-1188s1c1
Sequence:CCGGCTAACCTTTAGTCCTGCTCTACTCGAGTAGAGCAGGACTAAAGGTTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000177281    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_025724.1-1644s1c1
Sequence:CCGGGAACTGAGAAACGAAATGGAACTCGAGTTCCATTTCGTTTCTCAGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000197961    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_025724.1-1651s1c1
Sequence:CCGGGAAACGAAATGGAACCGATTTCTCGAGAAATCGGTTCCATTTCGTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_025724
CCER1 MISSION shRNA shRNA Plasmid DNA
coiled-coil glutamate-rich protein 1
Mouse
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000181438    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025724.1-1130s1c1
Sequence:CCGGCGTCGAAGAAGATTCGCAGTTCTCGAGAACTGCGAATCTTCTTCGACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000178579    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025724.1-1188s1c1
Sequence:CCGGCTAACCTTTAGTCCTGCTCTACTCGAGTAGAGCAGGACTAAAGGTTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000177281    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_025724.1-1644s1c1
Sequence:CCGGGAACTGAGAAACGAAATGGAACTCGAGTTCCATTTCGTTTCTCAGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000197961    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_025724.1-1651s1c1
Sequence:CCGGGAAACGAAATGGAACCGATTTCTCGAGAAATCGGTTCCATTTCGTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_025724
CCER1 MISSION shRNA Lentiviral Transduction Particles
coiled-coil glutamate-rich protein 1
Mouse
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000181438    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025724.1-1130s1c1
Sequence:CCGGCGTCGAAGAAGATTCGCAGTTCTCGAGAACTGCGAATCTTCTTCGACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000178579    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025724.1-1188s1c1
Sequence:CCGGCTAACCTTTAGTCCTGCTCTACTCGAGTAGAGCAGGACTAAAGGTTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000177281    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_025724.1-1644s1c1
Sequence:CCGGGAACTGAGAAACGAAATGGAACTCGAGTTCCATTTCGTTTCTCAGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000197961    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_025724.1-1651s1c1
Sequence:CCGGGAAACGAAATGGAACCGATTTCTCGAGAAATCGGTTCCATTTCGTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks