EMAIL THIS PAGE TO A FRIEND

CCHCR1

coiled-coil alpha-helical rod protein 1

66 Gene Product Result for
Synonyms: C6orf18 HCR SBP
Gene ID:
Mouse(240084) coiled-coil alpha-helical rod protein 1
Rat(406196) coiled-coil alpha-helical rod protein 1
domestic cat(101101468) coiled-coil alpha-helical rod protein 1
cow(514215) coiled-coil alpha-helical rod protein 1
dog(474834) coiled-coil alpha-helical rod protein 1
sheep(101104535) coiled-coil alpha-helical rod protein 1
naked mole-rat(101723697) coiled-coil alpha-helical rod protein 1
domestic guinea pig(100734735) coiled-coil alpha-helical rod protein 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_146248 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_146248 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_146248 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_019052 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_019052 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_019052 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EMU054941 MISSION® esiRNA esiRNA targeting mouse Cchcr1 (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001105563 Rosetta Predictions human pricing
NM_001105564 Rosetta Predictions human pricing
NM_019052 Rosetta Predictions human pricing
NM_001002822 Rosetta Predictions rat pricing
NM_146248 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001105563 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00324431 predicted 2598
2 SASI_Hs02_00324432 predicted 2459
3 SASI_Hs02_00324433 predicted 1368
4 SASI_Hs02_00324434 predicted 1854
5 SASI_Hs02_00324435 predicted 863
6 SASI_Hs02_00324436 predicted 2179
7 SASI_Hs02_00324437 predicted 1069
8 SASI_Hs02_00324438 predicted 1133
9 SASI_Hs02_00324439 predicted 2402
10 SASI_Hs02_00324440 predicted 2366
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001105564 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00324441 predicted 2715
2 SASI_Hs02_00324442 predicted 2567
3 SASI_Hs02_00324443 predicted 1481
4 SASI_Hs02_00324444 predicted 1960
5 SASI_Hs02_00324445 predicted 972
6 SASI_Hs02_00324446 predicted 2285
7 SASI_Hs02_00324447 predicted 1171
8 SASI_Hs02_00324448 predicted 1248
9 SASI_Hs02_00324449 predicted 2507
10 SASI_Hs02_00324450 predicted 2475
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_019052 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00035786 predicted 2374
2 SASI_Hs01_00035787 predicted 2231
3 SASI_Hs01_00035788 predicted 1150
4 SASI_Hs02_00352626 predicted 1632
5 SASI_Hs01_00035789 predicted 644
6 SASI_Hs01_00035790 predicted 1957
7 SASI_Hs01_00035791 predicted 844
8 SASI_Hs01_00035792 predicted 909
9 SASI_Hs01_00035793 predicted 2168
10 SASI_Hs01_00035794 predicted 2137
11 SASI_Hs01_00035795 predicted 1159
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001002822 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00198008 predicted 2487
2 SASI_Rn01_00098832 predicted 1276
3 SASI_Rn01_00098833 predicted 1079
4 SASI_Rn01_00098835 predicted 600
5 SASI_Rn01_00098836 predicted 1673
6 SASI_Rn02_00198009 predicted 758
7 SASI_Rn01_00098838 predicted 1698
8 SASI_Rn01_00098840 predicted 1692
9 SASI_Rn01_00098841 predicted 344
10 SASI_Rn02_00198010 predicted 1409
11 SASI_Rn01_00098834 predicted 1396
12 SASI_Rn01_00098837 predicted 2121
13 SASI_Rn01_00098839 predicted 932
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_146248 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00048193 predicted 2142
2 SASI_Mm01_00048194 predicted 512
3 SASI_Mm01_00048196 predicted 1111
4 SASI_Mm01_00048197 predicted 1046
5 SASI_Mm01_00048198 predicted 987
6 SASI_Mm01_00048199 predicted 1034
7 SASI_Mm01_00048200 predicted 2024
8 SASI_Mm01_00048201 predicted 1039
9 SASI_Mm02_00341982 predicted 269
10 SASI_Mm01_00048202 predicted 2389
11 SASI_Mm01_00048195 predicted 961
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_146248
VALIDATED
CCHCR1 MISSION shRNA Bacterial Glycerol Stock
coiled-coil alpha-helical rod protein 1
Mouse
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000258083    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146248.2-1570s21c1
Sequence:CCGGCGGAAGGTCCACACCATTAAGCTCGAGCTTAATGGTGTGGACCTTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000250612    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146248.2-2246s21c1
Sequence:CCGGTGCTTCCCTCGGGAGTGAATACTCGAGTATTCACTCCCGAGGGAAGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000250613    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_146248.2-1172s21c1
Sequence:CCGGACTGGCGGGAGAAGGTATTTGCTCGAGCAAATACCTTCTCCCGCCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000250614    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146248.2-2349s21c1
Sequence:CCGGCCTGACCGTCCTGCTTGATAACTCGAGTTATCAAGCAGGACGGTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000175295    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_146248.1-2479s1c1
Sequence:CCGGCCATTTCCAGAGATGAAGATACTCGAGTATCTTCATCTCTGGAAATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000173944    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_146248.1-2580s1c1
Sequence:CCGGGAAGAATGAAGCCAGCCTGAACTCGAGTTCAGGCTGGCTTCATTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_146248
VALIDATED
CCHCR1 MISSION shRNA shRNA Plasmid DNA
coiled-coil alpha-helical rod protein 1
Mouse
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000258083    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146248.2-1570s21c1
Sequence:CCGGCGGAAGGTCCACACCATTAAGCTCGAGCTTAATGGTGTGGACCTTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000250612    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146248.2-2246s21c1
Sequence:CCGGTGCTTCCCTCGGGAGTGAATACTCGAGTATTCACTCCCGAGGGAAGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000250613    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_146248.2-1172s21c1
Sequence:CCGGACTGGCGGGAGAAGGTATTTGCTCGAGCAAATACCTTCTCCCGCCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000250614    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146248.2-2349s21c1
Sequence:CCGGCCTGACCGTCCTGCTTGATAACTCGAGTTATCAAGCAGGACGGTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000175295    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_146248.1-2479s1c1
Sequence:CCGGCCATTTCCAGAGATGAAGATACTCGAGTATCTTCATCTCTGGAAATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000173944    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_146248.1-2580s1c1
Sequence:CCGGGAAGAATGAAGCCAGCCTGAACTCGAGTTCAGGCTGGCTTCATTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_146248
VALIDATED
CCHCR1 MISSION shRNA Lentiviral Transduction Particles
coiled-coil alpha-helical rod protein 1
Mouse
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000258083    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146248.2-1570s21c1
Sequence:CCGGCGGAAGGTCCACACCATTAAGCTCGAGCTTAATGGTGTGGACCTTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000250612    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146248.2-2246s21c1
Sequence:CCGGTGCTTCCCTCGGGAGTGAATACTCGAGTATTCACTCCCGAGGGAAGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000250613    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_146248.2-1172s21c1
Sequence:CCGGACTGGCGGGAGAAGGTATTTGCTCGAGCAAATACCTTCTCCCGCCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000250614    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146248.2-2349s21c1
Sequence:CCGGCCTGACCGTCCTGCTTGATAACTCGAGTTATCAAGCAGGACGGTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000175295    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_146248.1-2479s1c1
Sequence:CCGGCCATTTCCAGAGATGAAGATACTCGAGTATCTTCATCTCTGGAAATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000173944    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_146248.1-2580s1c1
Sequence:CCGGGAAGAATGAAGCCAGCCTGAACTCGAGTTCAGGCTGGCTTCATTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_019052
VALIDATED
CCHCR1 MISSION shRNA Bacterial Glycerol Stock
coiled-coil alpha-helical rod protein 1
Human
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000142543    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019052.2-2720s1c1
Sequence:CCGGGTTTGTCAAGGAGACAACCTTCTCGAGAAGGTTGTCTCCTTGACAAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000140604    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_019052.2-2461s1c1
Sequence:CCGGGAGGGATAAGAACCTCATGCTCTCGAGAGCATGAGGTTCTTATCCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000139799    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019052.2-489s1c1
Sequence:CCGGCCCTTTCAACTCTGCCAAGAACTCGAGTTCTTGGCAGAGTTGAAAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000139578    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 1 Clone ID:NM_019052.2-551s1c1
Sequence:CCGGCCAGGCTATCAAGATGTCTCACTCGAGTGAGACATCTTGATAGCCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000139691    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_019052.2-2726s1c1
Sequence:CCGGCAAGGAGACAACCTTGACAGACTCGAGTCTGTCAAGGTTGTCTCCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000139740    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_019052.2-1040s1c1
Sequence:CCGGCTGAGTAGTCTGGAAACCAGACTCGAGTCTGGTTTCCAGACTACTCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000139942    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_019052.2-1033s1c1
Sequence:CCGGGAAGTCTCTGAGTAGTCTGGACTCGAGTCCAGACTACTCAGAGACTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000140110    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_019052.2-2699s1c1
Sequence:CCGGGCCATTTCCAAAGAGGAAGCTCTCGAGAGCTTCCTCTTTGGAAATGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000140482    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_019052.2-893s1c1
Sequence:CCGGGTTGTCCGGAAGAACTTGGAACTCGAGTTCCAAGTTCTTCCGGACAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000140529    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_019052.2-2711s1c1
Sequence:CCGGGAGGAAGCTGTTTGTCAAGGACTCGAGTCCTTGACAAACAGCTTCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000141626    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_019052.2-2690s1c1
Sequence:CCGGCTGAGTGAAGCCATTTCCAAACTCGAGTTTGGAAATGGCTTCACTCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000140708    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_019052.2-1157s1c1
Sequence:CCGGGTGACCCTGGTTGAGAATCTACTCGAGTAGATTCTCAACCAGGGTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_019052
VALIDATED
CCHCR1 MISSION shRNA shRNA Plasmid DNA
coiled-coil alpha-helical rod protein 1
Human
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000142543    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019052.2-2720s1c1
Sequence:CCGGGTTTGTCAAGGAGACAACCTTCTCGAGAAGGTTGTCTCCTTGACAAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000140604    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_019052.2-2461s1c1
Sequence:CCGGGAGGGATAAGAACCTCATGCTCTCGAGAGCATGAGGTTCTTATCCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000139799    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019052.2-489s1c1
Sequence:CCGGCCCTTTCAACTCTGCCAAGAACTCGAGTTCTTGGCAGAGTTGAAAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000139578    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 1 Clone ID:NM_019052.2-551s1c1
Sequence:CCGGCCAGGCTATCAAGATGTCTCACTCGAGTGAGACATCTTGATAGCCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000139691    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_019052.2-2726s1c1
Sequence:CCGGCAAGGAGACAACCTTGACAGACTCGAGTCTGTCAAGGTTGTCTCCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000139740    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_019052.2-1040s1c1
Sequence:CCGGCTGAGTAGTCTGGAAACCAGACTCGAGTCTGGTTTCCAGACTACTCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000139942    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_019052.2-1033s1c1
Sequence:CCGGGAAGTCTCTGAGTAGTCTGGACTCGAGTCCAGACTACTCAGAGACTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000140110    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_019052.2-2699s1c1
Sequence:CCGGGCCATTTCCAAAGAGGAAGCTCTCGAGAGCTTCCTCTTTGGAAATGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000140482    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_019052.2-893s1c1
Sequence:CCGGGTTGTCCGGAAGAACTTGGAACTCGAGTTCCAAGTTCTTCCGGACAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000140529    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_019052.2-2711s1c1
Sequence:CCGGGAGGAAGCTGTTTGTCAAGGACTCGAGTCCTTGACAAACAGCTTCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000141626    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_019052.2-2690s1c1
Sequence:CCGGCTGAGTGAAGCCATTTCCAAACTCGAGTTTGGAAATGGCTTCACTCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000140708    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_019052.2-1157s1c1
Sequence:CCGGGTGACCCTGGTTGAGAATCTACTCGAGTAGATTCTCAACCAGGGTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_019052
VALIDATED
CCHCR1 MISSION shRNA Lentiviral Transduction Particles
coiled-coil alpha-helical rod protein 1
Human
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000142543    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019052.2-2720s1c1
Sequence:CCGGGTTTGTCAAGGAGACAACCTTCTCGAGAAGGTTGTCTCCTTGACAAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000140604    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_019052.2-2461s1c1
Sequence:CCGGGAGGGATAAGAACCTCATGCTCTCGAGAGCATGAGGTTCTTATCCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000139799    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019052.2-489s1c1
Sequence:CCGGCCCTTTCAACTCTGCCAAGAACTCGAGTTCTTGGCAGAGTTGAAAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000139578    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 1 Clone ID:NM_019052.2-551s1c1
Sequence:CCGGCCAGGCTATCAAGATGTCTCACTCGAGTGAGACATCTTGATAGCCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000139691    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_019052.2-2726s1c1
Sequence:CCGGCAAGGAGACAACCTTGACAGACTCGAGTCTGTCAAGGTTGTCTCCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000139740    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_019052.2-1040s1c1
Sequence:CCGGCTGAGTAGTCTGGAAACCAGACTCGAGTCTGGTTTCCAGACTACTCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000139942    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_019052.2-1033s1c1
Sequence:CCGGGAAGTCTCTGAGTAGTCTGGACTCGAGTCCAGACTACTCAGAGACTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000140110    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_019052.2-2699s1c1
Sequence:CCGGGCCATTTCCAAAGAGGAAGCTCTCGAGAGCTTCCTCTTTGGAAATGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000140482    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_019052.2-893s1c1
Sequence:CCGGGTTGTCCGGAAGAACTTGGAACTCGAGTTCCAAGTTCTTCCGGACAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000140529    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_019052.2-2711s1c1
Sequence:CCGGGAGGAAGCTGTTTGTCAAGGACTCGAGTCCTTGACAAACAGCTTCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000141626    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_019052.2-2690s1c1
Sequence:CCGGCTGAGTGAAGCCATTTCCAAACTCGAGTTTGGAAATGGCTTCACTCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000140708    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_019052.2-1157s1c1
Sequence:CCGGGTGACCCTGGTTGAGAATCTACTCGAGTAGATTCTCAACCAGGGTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks