EMAIL THIS PAGE TO A FRIEND

CCIN

calicin

Synonyms: BTBD20
UniProtKB ID: Q13939, Q9BXG7
Gene ID:
Human(881) Summary: The protein encoded by this gene is a basic protein of the sperm head cytoskeleton. This protein contains kelch repeats and a BTB/POZ domain and is necessary for normal morphology during sperm differentiation. This gene is intronless. [provided by RefSeq, Jul 2008]
Mouse(442829) calicin
Rat(298392) calicin
dog(474764) calicin
cow(281041) calicin
49 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
AV53646 Anti-CCIN antibody produced in rabbit affinity isolated antibody rabbit, human, guinea pig, bovine, canine, mouse, rat, horse
western blot pricing
HPA019611 Anti-CCIN antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human, mouse, rat
immunohistochemistry pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001002787 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001002787 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001002787 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_005893 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_005893 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_005893 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_005893 Rosetta Predictions human pricing
NM_001005904 Rosetta Predictions rat pricing
NM_001002787 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_005893 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00045808 predicted 461
2 SASI_Hs01_00045809 predicted 775
3 SASI_Hs01_00045810 predicted 1266
4 SASI_Hs01_00045811 predicted 560
5 SASI_Hs01_00045814 predicted 848
6 SASI_Hs01_00045815 predicted 548
7 SASI_Hs01_00045816 predicted 455
8 SASI_Hs01_00045817 predicted 704
9 SASI_Hs02_00340492 predicted 330
10 SASI_Hs02_00340493 predicted 980
11 SASI_Hs01_00045812 predicted 1290
12 SASI_Hs01_00045813 predicted 1032
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001005904 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00198489 predicted 1070
2 SASI_Rn01_00118665 predicted 1608
3 SASI_Rn01_00118666 predicted 416
4 SASI_Rn01_00118667 predicted 1270
5 SASI_Rn01_00118668 predicted 762
6 SASI_Rn01_00118669 predicted 328
7 SASI_Rn01_00118670 predicted 405
8 SASI_Rn01_00118671 predicted 1575
9 SASI_Rn01_00118672 predicted 1219
10 SASI_Rn01_00118673 predicted 313
11 SASI_Rn01_00118664 predicted 952
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001002787 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00040662 predicted 1252
2 SASI_Mm01_00040663 predicted 797
3 SASI_Mm02_00286298 predicted 1101
4 SASI_Mm02_00286299 predicted 761
5 SASI_Mm01_00040664 predicted 1709
6 SASI_Mm01_00040665 predicted 437
7 SASI_Mm01_00040667 predicted 686
8 SASI_Mm01_00040668 predicted 1732
9 SASI_Mm01_00040669 predicted 1607
10 SASI_Mm01_00040670 predicted 365
11 SASI_Mm01_00040666 predicted 1642
12 SASI_Mm01_00040671 predicted 1081
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001002787
CCIN MISSION shRNA Bacterial Glycerol Stock
calicin
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000106405    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001002787.1-1875s1c1
Sequence:CCGGTGGGAGAATAAGTAAATGCATCTCGAGATGCATTTACTTATTCTCCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000106409    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001002787.1-163s1c1
Sequence:CCGGGCGTAAAGAGTACTGGGACATCTCGAGATGTCCCAGTACTCTTTACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000106408    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001002787.1-1555s1c1
Sequence:CCGGCGTGGAAATCAACTTACAGAACTCGAGTTCTGTAAGTTGATTTCCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000106406    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001002787.1-1261s1c1
Sequence:CCGGCGTCTCTAACATTTATCGCTACTCGAGTAGCGATAAATGTTAGAGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000106407    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001002787.1-790s1c1
Sequence:CCGGGCTGATGTTTGCCAGCAACAACTCGAGTTGTTGCTGGCAAACATCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001002787
CCIN MISSION shRNA shRNA Plasmid DNA
calicin
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000106405    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001002787.1-1875s1c1
Sequence:CCGGTGGGAGAATAAGTAAATGCATCTCGAGATGCATTTACTTATTCTCCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000106409    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001002787.1-163s1c1
Sequence:CCGGGCGTAAAGAGTACTGGGACATCTCGAGATGTCCCAGTACTCTTTACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000106408    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001002787.1-1555s1c1
Sequence:CCGGCGTGGAAATCAACTTACAGAACTCGAGTTCTGTAAGTTGATTTCCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000106406    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001002787.1-1261s1c1
Sequence:CCGGCGTCTCTAACATTTATCGCTACTCGAGTAGCGATAAATGTTAGAGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000106407    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001002787.1-790s1c1
Sequence:CCGGGCTGATGTTTGCCAGCAACAACTCGAGTTGTTGCTGGCAAACATCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001002787
CCIN MISSION shRNA Lentiviral Transduction Particles
calicin
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000106405    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001002787.1-1875s1c1
Sequence:CCGGTGGGAGAATAAGTAAATGCATCTCGAGATGCATTTACTTATTCTCCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000106409    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001002787.1-163s1c1
Sequence:CCGGGCGTAAAGAGTACTGGGACATCTCGAGATGTCCCAGTACTCTTTACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000106408    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001002787.1-1555s1c1
Sequence:CCGGCGTGGAAATCAACTTACAGAACTCGAGTTCTGTAAGTTGATTTCCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000106406    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001002787.1-1261s1c1
Sequence:CCGGCGTCTCTAACATTTATCGCTACTCGAGTAGCGATAAATGTTAGAGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000106407    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001002787.1-790s1c1
Sequence:CCGGGCTGATGTTTGCCAGCAACAACTCGAGTTGTTGCTGGCAAACATCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_005893
CCIN MISSION shRNA Bacterial Glycerol Stock
calicin
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000163482    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_005893.1-1147s1c1
Sequence:CCGGGCGGTATGACATGGATGACAACTCGAGTTGTCATCCATGTCATACCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000162812    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_005893.1-1726s1c1
Sequence:CCGGCCAGACAAAGGACTACACCATCTCGAGATGGTGTAGTCCTTTGTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000161354    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_005893.1-1729s1c1
Sequence:CCGGGACAAAGGACTACACCATCAACTCGAGTTGATGGTGTAGTCCTTTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000161167    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_005893.1-431s1c1
Sequence:CCGGGCTCAGTATTTCAACACACCACTCGAGTGGTGTGTTGAAATACTGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000161239    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_005893.1-461s1c1
Sequence:CCGGGTTCACTGTAACGACTTCCTTCTCGAGAAGGAAGTCGTTACAGTGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000162665    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_005893.1-982s1c1
Sequence:CCGGCCAGTTCAATGATGGAGTGTTCTCGAGAACACTCCATCATTGAACTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000436035    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005893.2-469s21c1
Sequence:CCGGTGTAACGACTTCCTTATTAAGCTCGAGCTTAATAAGGAAGTCGTTACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000420616    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005893.2-1650s21c1
Sequence:CCGGGGATGTGTCCCATGCTATATGCTCGAGCATATAGCATGGGACACATCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_005893
CCIN MISSION shRNA shRNA Plasmid DNA
calicin
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000163482    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_005893.1-1147s1c1
Sequence:CCGGGCGGTATGACATGGATGACAACTCGAGTTGTCATCCATGTCATACCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000162812    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_005893.1-1726s1c1
Sequence:CCGGCCAGACAAAGGACTACACCATCTCGAGATGGTGTAGTCCTTTGTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000161354    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_005893.1-1729s1c1
Sequence:CCGGGACAAAGGACTACACCATCAACTCGAGTTGATGGTGTAGTCCTTTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000161167    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_005893.1-431s1c1
Sequence:CCGGGCTCAGTATTTCAACACACCACTCGAGTGGTGTGTTGAAATACTGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000161239    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_005893.1-461s1c1
Sequence:CCGGGTTCACTGTAACGACTTCCTTCTCGAGAAGGAAGTCGTTACAGTGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000162665    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_005893.1-982s1c1
Sequence:CCGGCCAGTTCAATGATGGAGTGTTCTCGAGAACACTCCATCATTGAACTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000436035    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005893.2-469s21c1
Sequence:CCGGTGTAACGACTTCCTTATTAAGCTCGAGCTTAATAAGGAAGTCGTTACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000420616    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005893.2-1650s21c1
Sequence:CCGGGGATGTGTCCCATGCTATATGCTCGAGCATATAGCATGGGACACATCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_005893
CCIN MISSION shRNA Lentiviral Transduction Particles
calicin
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000163482    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_005893.1-1147s1c1
Sequence:CCGGGCGGTATGACATGGATGACAACTCGAGTTGTCATCCATGTCATACCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000162812    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_005893.1-1726s1c1
Sequence:CCGGCCAGACAAAGGACTACACCATCTCGAGATGGTGTAGTCCTTTGTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000161354    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_005893.1-1729s1c1
Sequence:CCGGGACAAAGGACTACACCATCAACTCGAGTTGATGGTGTAGTCCTTTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000161167    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_005893.1-431s1c1
Sequence:CCGGGCTCAGTATTTCAACACACCACTCGAGTGGTGTGTTGAAATACTGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000161239    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_005893.1-461s1c1
Sequence:CCGGGTTCACTGTAACGACTTCCTTCTCGAGAAGGAAGTCGTTACAGTGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000162665    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_005893.1-982s1c1
Sequence:CCGGCCAGTTCAATGATGGAGTGTTCTCGAGAACACTCCATCATTGAACTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000436035    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005893.2-469s21c1
Sequence:CCGGTGTAACGACTTCCTTATTAAGCTCGAGCTTAATAAGGAAGTCGTTACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000420616    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005893.2-1650s21c1
Sequence:CCGGGGATGTGTCCCATGCTATATGCTCGAGCATATAGCATGGGACACATCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks