EMAIL THIS PAGE TO A FRIEND

CCK

cholecystokinin

53 Gene Product Result for
UniProtKB ID: P06307
Gene ID:
Human(885) Summary: Cholecystokinin is a brain/gut peptide. In the gut, it induces the release of pancreatic enzymes and the contraction of the gallbladder. In the brain, its physiologic role is unclear. The cholecystokinin pro-hormone is processed by endo- and exo-proteolytic cleavages. Two transcript variants encoding the same protein have been found for this gene. [provided by RefSeq, Mar 2010]
Mouse(12424) cholecystokinin
Rat(25298) cholecystokinin
sheep(101116683) cholecystokinin
naked mole-rat(101719515) cholecystokinin
Zebrafish(100007763) cholecystokinin
chicken(414884) cholecystokinin
cow(617510) cholecystokinin
domestic cat(100271847) cholecystokinin
domestic cat(101096837) cholecystokinin
dog(609547) cholecystokinin
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB2100357 Anti-CCK antibody produced in rabbit affinity isolated antibody mouse, guinea pig, bovine, rabbit, human, rat, pig, canine, horse
western blot pricing
C2581 Anti-Cholecystokinin (26-33) (CCK-8) antibody produced in rabbit whole antiserum human
immunohistochemistry, radioimmunoassay pricing
SAB1402711 Monoclonal Anti-CCK antibody produced in mouse clone 2A5, purified immunoglobulin, buffered aqueous solution human
ELISA pricing

Small Molecule - Antagonist

Product # Description Species Add to Cart
 
M006 Proglumide sodium salt solid human, mouse, rat pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_000729 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_000729 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_000729 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_031161 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_031161 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_031161 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU059721 MISSION® esiRNA esiRNA human CCK (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000729 Rosetta Predictions human pricing
NM_012829 Rosetta Predictions rat pricing
NM_031161 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000729 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00233676 predicted 382
2 SASI_Hs01_00233677 predicted 518
3 SASI_Hs01_00233678 predicted 516
4 SASI_Hs01_00233679 predicted 413
5 SASI_Hs01_00233680 predicted 433
6 SASI_Hs01_00233681 predicted 217
7 SASI_Hs01_00233682 predicted 431
8 SASI_Hs01_00233683 predicted 518
9 SASI_Hs01_00233684 predicted 489
10 SASI_Hs01_00233685 predicted 345
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_012829 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00041329 predicted 412
2 SASI_Rn01_00041330 predicted 333
3 SASI_Rn01_00041331 predicted 320
4 SASI_Rn01_00041332 predicted 235
5 SASI_Rn01_00041333 predicted 331
6 SASI_Rn01_00041334 predicted 416
7 SASI_Rn02_00260281 predicted 354
8 SASI_Rn01_00041335 predicted 389
9 SASI_Rn01_00041336 predicted 292
10 SASI_Rn02_00260282 predicted 241
11 SASI_Rn01_00041327 predicted 427
12 SASI_Rn01_00041328 predicted 425
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_031161 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00064309 predicted 375
2 SASI_Mm01_00064310 predicted 288
3 SASI_Mm01_00064311 predicted 286
4 SASI_Mm01_00064312 predicted 347
5 SASI_Mm01_00064313 predicted 344
6 SASI_Mm01_00064314 predicted 251
7 SASI_Mm02_00336973 predicted 377
8 SASI_Mm01_00064316 predicted 235
9 SASI_Mm01_00064317 predicted 241
10 SASI_Mm01_00064318 predicted 237
11 SASI_Mm01_00064315 predicted 243
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_000729
CCK MISSION shRNA Bacterial Glycerol Stock
cholecystokinin
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000377737    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000729.3-389s21c1
Sequence:CCGGCCTGCTGGCAAGATACATCCACTCGAGTGGATGTATCTTGCCAGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000371587    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000729.3-599s21c1
Sequence:CCGGACCCAGAGGAGGCAGAATAAGCTCGAGCTTATTCTGCCTCCTCTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000371648    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000729.3-337s21c1
Sequence:CCGGAGCTGAGGGTATCGCAGAGAACTCGAGTTCTCTGCGATACCCTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000371588    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000729.3-623s21c1
Sequence:CCGGACAATCACACTCATAACTCATCTCGAGATGAGTTATGAGTGTGATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000061958    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_000729.3-647s1c1
Sequence:CCGGCTGTGGAGTTTGACATTGTATCTCGAGATACAATGTCAAACTCCACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000061959    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000729.3-431s1c1
Sequence:CCGGTGGACGAATGTCCATCGTTAACTCGAGTTAACGATGGACATTCGTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000061960    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000729.3-419s1c1
Sequence:CCGGGAAAGCTCCTTCTGGACGAATCTCGAGATTCGTCCAGAAGGAGCTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000061962    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000729.3-521s1c1
Sequence:CCGGCCGTCGCAGTGCCGAGGAGTACTCGAGTACTCCTCGGCACTGCGACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000061961    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000729.3-491s1c1
Sequence:CCGGCCGGGACTACATGGGCTGGATCTCGAGATCCAGCCCATGTAGTCCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_000729
CCK MISSION shRNA shRNA Plasmid DNA
cholecystokinin
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000377737    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000729.3-389s21c1
Sequence:CCGGCCTGCTGGCAAGATACATCCACTCGAGTGGATGTATCTTGCCAGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000371587    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000729.3-599s21c1
Sequence:CCGGACCCAGAGGAGGCAGAATAAGCTCGAGCTTATTCTGCCTCCTCTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000371648    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000729.3-337s21c1
Sequence:CCGGAGCTGAGGGTATCGCAGAGAACTCGAGTTCTCTGCGATACCCTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000371588    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000729.3-623s21c1
Sequence:CCGGACAATCACACTCATAACTCATCTCGAGATGAGTTATGAGTGTGATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000061958    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_000729.3-647s1c1
Sequence:CCGGCTGTGGAGTTTGACATTGTATCTCGAGATACAATGTCAAACTCCACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000061959    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000729.3-431s1c1
Sequence:CCGGTGGACGAATGTCCATCGTTAACTCGAGTTAACGATGGACATTCGTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000061960    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000729.3-419s1c1
Sequence:CCGGGAAAGCTCCTTCTGGACGAATCTCGAGATTCGTCCAGAAGGAGCTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000061962    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000729.3-521s1c1
Sequence:CCGGCCGTCGCAGTGCCGAGGAGTACTCGAGTACTCCTCGGCACTGCGACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000061961    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000729.3-491s1c1
Sequence:CCGGCCGGGACTACATGGGCTGGATCTCGAGATCCAGCCCATGTAGTCCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_000729
CCK MISSION shRNA Lentiviral Transduction Particles
cholecystokinin
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000377737    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000729.3-389s21c1
Sequence:CCGGCCTGCTGGCAAGATACATCCACTCGAGTGGATGTATCTTGCCAGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000371587    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000729.3-599s21c1
Sequence:CCGGACCCAGAGGAGGCAGAATAAGCTCGAGCTTATTCTGCCTCCTCTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000371648    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000729.3-337s21c1
Sequence:CCGGAGCTGAGGGTATCGCAGAGAACTCGAGTTCTCTGCGATACCCTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000371588    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000729.3-623s21c1
Sequence:CCGGACAATCACACTCATAACTCATCTCGAGATGAGTTATGAGTGTGATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000061958    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_000729.3-647s1c1
Sequence:CCGGCTGTGGAGTTTGACATTGTATCTCGAGATACAATGTCAAACTCCACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000061959    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000729.3-431s1c1
Sequence:CCGGTGGACGAATGTCCATCGTTAACTCGAGTTAACGATGGACATTCGTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000061960    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000729.3-419s1c1
Sequence:CCGGGAAAGCTCCTTCTGGACGAATCTCGAGATTCGTCCAGAAGGAGCTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000061962    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000729.3-521s1c1
Sequence:CCGGCCGTCGCAGTGCCGAGGAGTACTCGAGTACTCCTCGGCACTGCGACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000061961    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000729.3-491s1c1
Sequence:CCGGCCGGGACTACATGGGCTGGATCTCGAGATCCAGCCCATGTAGTCCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_031161
VALIDATED
CCK MISSION shRNA Bacterial Glycerol Stock
cholecystokinin
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000319740    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031161.2-260s21c1
Sequence:CCGGTACATCCAGCAGGTCCGCAAACTCGAGTTTGCGGACCTGCTGGATGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000317989    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_031161.2-481s21c1
Sequence:CCGGCGCCTCTAATGTCTGACGTTTCTCGAGAAACGTCAGACATTAGAGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000317918    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031161.2-289s21c1
Sequence:CCGGTGGCCGCATGTCCGTTCTTAACTCGAGTTAAGAACGGACATGCGGCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000319678    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031161.2-386s21c1
Sequence:CCGGAGTGCCGAGGACTACGAATACCTCGAGGTATTCGTAGTCCTCGGCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000350175    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031161.2-355s21c1
Sequence:CCGGCTACATGGGCTGGATGGATTTCTCGAGAAATCCATCCAGCCCATGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000088868    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_031161.1-481s1c1
Sequence:CCGGCGCCTCTAATGTCTGACGTTTCTCGAGAAACGTCAGACATTAGAGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000088869    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031161.1-334s1c1
Sequence:CCGGCCATAGAATAAGTGACCGGGACTCGAGTCCCGGTCACTTATTCTATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000088871    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031161.1-390s1c1
Sequence:CCGGCCGAGGACTACGAATACCCATCTCGAGATGGGTATTCGTAGTCCTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000088872    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_031161.1-289s1c1
Sequence:CCGGTGGCCGCATGTCCGTTCTTAACTCGAGTTAAGAACGGACATGCGGCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000088870    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031161.1-244s1c1
Sequence:CCGGCGCACTGCTAGCGCGATACATCTCGAGATGTATCGCGCTAGCAGTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_031161
VALIDATED
CCK MISSION shRNA shRNA Plasmid DNA
cholecystokinin
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000319740    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031161.2-260s21c1
Sequence:CCGGTACATCCAGCAGGTCCGCAAACTCGAGTTTGCGGACCTGCTGGATGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000317989    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_031161.2-481s21c1
Sequence:CCGGCGCCTCTAATGTCTGACGTTTCTCGAGAAACGTCAGACATTAGAGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000317918    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031161.2-289s21c1
Sequence:CCGGTGGCCGCATGTCCGTTCTTAACTCGAGTTAAGAACGGACATGCGGCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000319678    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031161.2-386s21c1
Sequence:CCGGAGTGCCGAGGACTACGAATACCTCGAGGTATTCGTAGTCCTCGGCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000350175    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031161.2-355s21c1
Sequence:CCGGCTACATGGGCTGGATGGATTTCTCGAGAAATCCATCCAGCCCATGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000088868    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_031161.1-481s1c1
Sequence:CCGGCGCCTCTAATGTCTGACGTTTCTCGAGAAACGTCAGACATTAGAGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000088869    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031161.1-334s1c1
Sequence:CCGGCCATAGAATAAGTGACCGGGACTCGAGTCCCGGTCACTTATTCTATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000088871    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031161.1-390s1c1
Sequence:CCGGCCGAGGACTACGAATACCCATCTCGAGATGGGTATTCGTAGTCCTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000088872    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_031161.1-289s1c1
Sequence:CCGGTGGCCGCATGTCCGTTCTTAACTCGAGTTAAGAACGGACATGCGGCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000088870    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031161.1-244s1c1
Sequence:CCGGCGCACTGCTAGCGCGATACATCTCGAGATGTATCGCGCTAGCAGTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_031161
VALIDATED
CCK MISSION shRNA Lentiviral Transduction Particles
cholecystokinin
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000319740    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031161.2-260s21c1
Sequence:CCGGTACATCCAGCAGGTCCGCAAACTCGAGTTTGCGGACCTGCTGGATGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000317989    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_031161.2-481s21c1
Sequence:CCGGCGCCTCTAATGTCTGACGTTTCTCGAGAAACGTCAGACATTAGAGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000317918    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031161.2-289s21c1
Sequence:CCGGTGGCCGCATGTCCGTTCTTAACTCGAGTTAAGAACGGACATGCGGCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000319678    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031161.2-386s21c1
Sequence:CCGGAGTGCCGAGGACTACGAATACCTCGAGGTATTCGTAGTCCTCGGCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000350175    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031161.2-355s21c1
Sequence:CCGGCTACATGGGCTGGATGGATTTCTCGAGAAATCCATCCAGCCCATGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000088868    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_031161.1-481s1c1
Sequence:CCGGCGCCTCTAATGTCTGACGTTTCTCGAGAAACGTCAGACATTAGAGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000088869    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031161.1-334s1c1
Sequence:CCGGCCATAGAATAAGTGACCGGGACTCGAGTCCCGGTCACTTATTCTATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000088871    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031161.1-390s1c1
Sequence:CCGGCCGAGGACTACGAATACCCATCTCGAGATGGGTATTCGTAGTCCTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000088872    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_031161.1-289s1c1
Sequence:CCGGTGGCCGCATGTCCGTTCTTAACTCGAGTTAAGAACGGACATGCGGCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000088870    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031161.1-244s1c1
Sequence:CCGGCGCACTGCTAGCGCGATACATCTCGAGATGTATCGCGCTAGCAGTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks