EMAIL THIS PAGE TO A FRIEND

CCKAR

cholecystokinin A receptor

74 Gene Product Result for
Synonyms: CCK-A CCK1-R CCKRA
UniProtKB ID: P32238, B2R9Z5
Gene ID:
Human(886) Summary: This gene encodes a G-protein coupled receptor that binds non-sulfated members of the cholecystokinin (CCK) family of peptide hormones. This receptor is a major physiologic mediator of pancreatic enzyme secretion and smooth muscle contraction of the gallbladder and stomach. In the central and peripheral nervous system this receptor regulates satiety and the release of beta-endorphin and dopamine. [provided by RefSeq, Jul 2008]
Mouse(12425) cholecystokinin A receptor
Rat(24889) cholecystokinin A receptor
chicken(422801) cholecystokinin A receptor
cow(506207) cholecystokinin A receptor
Horse(100055506) cholecystokinin A receptor
dog(488846) cholecystokinin A receptor
domestic cat(101099960) cholecystokinin A receptor
domestic guinea pig(100719593) cholecystokinin A receptor
naked mole-rat(101726254) cholecystokinin A receptor
sheep(101108047) cholecystokinin A receptor
Domestic Rabbit(100009241) cholecystokinin A receptor
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Small Molecule - Inhibitor

Product # Description Species Add to Cart
 
C2175 (Tyr[SO3H]27)Cholecystokinin fragment 26-33 Amide ≥97% (HPLC), powder human, rat pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_000730 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_000730 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_000730 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_009827 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_009827 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_009827 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000730 Rosetta Predictions human pricing
NM_012688 Rosetta Predictions rat pricing
NM_009827 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000730 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00106378 predicted 829
2 SASI_Hs01_00106379 predicted 527
3 SASI_Hs01_00106380 predicted 280
4 SASI_Hs01_00106381 predicted 566
5 SASI_Hs01_00106382 predicted 725
6 SASI_Hs01_00106384 predicted 283
7 SASI_Hs01_00106385 predicted 785
8 SASI_Hs01_00106386 predicted 928
9 SASI_Hs01_00106387 predicted 195
10 SASI_Hs02_00303156 predicted 848
11 SASI_Hs01_00106383 predicted 746
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_012688 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00082195 predicted 318
2 SASI_Rn02_00259989 predicted 1019
3 SASI_Rn02_00259990 predicted 586
4 SASI_Rn02_00259991 predicted 469
5 SASI_Rn02_00259992 predicted 321
6 SASI_Rn02_00259993 predicted 306
7 SASI_Rn02_00259994 predicted 454
8 SASI_Rn02_00259995 predicted 590
9 SASI_Rn02_00259996 predicted 810
10 SASI_Rn02_00259997 predicted 822
11 SASI_Rn01_00082196 predicted 339
12 SASI_Rn01_00082197 predicted 2031
13 SASI_Rn01_00082198 predicted 1835
14 SASI_Rn01_00082199 predicted 881
15 SASI_Rn01_00082200 predicted 2039
16 SASI_Rn01_00082201 predicted 1036
17 SASI_Rn01_00082202 predicted 857
18 SASI_Rn01_00082203 predicted 271
19 SASI_Rn01_00082204 predicted 828
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_009827 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00317168 predicted 1947
2 SASI_Mm02_00317169 predicted 430
3 SASI_Mm01_00056697 predicted 795
4 SASI_Mm01_00056698 predicted 2059
5 SASI_Mm01_00056701 predicted 468
6 SASI_Mm02_00317170 predicted 1733
7 SASI_Mm02_00317171 predicted 1735
8 SASI_Mm02_00317172 predicted 394
9 SASI_Mm02_00317173 predicted 1611
10 SASI_Mm02_00317174 predicted 523
11 SASI_Mm01_00056695 predicted 922
12 SASI_Mm01_00056696 predicted 863
13 SASI_Mm01_00056699 predicted 942
14 SASI_Mm01_00056700 predicted 1251
15 SASI_Mm01_00056702 predicted 2384
16 SASI_Mm01_00056703 predicted 1144
17 SASI_Mm01_00056704 predicted 1009
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_000730
CCKAR MISSION shRNA Bacterial Glycerol Stock
cholecystokinin A receptor
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000008181    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_000730.1-1478s1c1
Sequence:CCGGGAGGAGGCAGAGAAGAAAGAACTCGAGTTCTTTCTTCTCTGCCTCCTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000008183    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000730.1-790s1c1
Sequence:CCGGCTGTTACTCATCCTCTTTCTTCTCGAGAAGAAAGAGGATGAGTAACAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000008182    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000730.1-562s1c1
Sequence:CCGGCTAGAGAGATATGGTGCGATTCTCGAGAATCGCACCATATCTCTCTAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000011237    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000730.1-282s1c1
Sequence:CCGGGCAGATTCTCTTGTACTCCTTCTCGAGAAGGAGTACAAGAGAATCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000356745    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000730.2-717s21c1
Sequence:CCGGTAACAACCAGACCGCGAATATCTCGAGATATTCGCGGTCTGGTTGTTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000356746    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000730.2-740s21c1
Sequence:CCGGGCCGCTTTCTACTGCCAAATGCTCGAGCATTTGGCAGTAGAAAGCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000356744    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000730.2-539s21c1
Sequence:CCGGCCTTTAATCTGGTAGCCATATCTCGAGATATGGCTACCAGATTAAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000378135    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000730.2-922s21c1
Sequence:CCGGACCACCAGCAGCGGCAAATATCTCGAGATATTTGCCGCTGCTGGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000356805    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000730.2-289s21c1
Sequence:CCGGCTCTTGTACTCCTTGATATTCCTCGAGGAATATCAAGGAGTACAAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_000730
CCKAR MISSION shRNA shRNA Plasmid DNA
cholecystokinin A receptor
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000008181    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_000730.1-1478s1c1
Sequence:CCGGGAGGAGGCAGAGAAGAAAGAACTCGAGTTCTTTCTTCTCTGCCTCCTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000008183    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000730.1-790s1c1
Sequence:CCGGCTGTTACTCATCCTCTTTCTTCTCGAGAAGAAAGAGGATGAGTAACAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000008182    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000730.1-562s1c1
Sequence:CCGGCTAGAGAGATATGGTGCGATTCTCGAGAATCGCACCATATCTCTCTAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000011237    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000730.1-282s1c1
Sequence:CCGGGCAGATTCTCTTGTACTCCTTCTCGAGAAGGAGTACAAGAGAATCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000356745    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000730.2-717s21c1
Sequence:CCGGTAACAACCAGACCGCGAATATCTCGAGATATTCGCGGTCTGGTTGTTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000356746    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000730.2-740s21c1
Sequence:CCGGGCCGCTTTCTACTGCCAAATGCTCGAGCATTTGGCAGTAGAAAGCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000356744    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000730.2-539s21c1
Sequence:CCGGCCTTTAATCTGGTAGCCATATCTCGAGATATGGCTACCAGATTAAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000378135    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000730.2-922s21c1
Sequence:CCGGACCACCAGCAGCGGCAAATATCTCGAGATATTTGCCGCTGCTGGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000356805    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000730.2-289s21c1
Sequence:CCGGCTCTTGTACTCCTTGATATTCCTCGAGGAATATCAAGGAGTACAAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_000730
CCKAR MISSION shRNA Lentiviral Transduction Particles
cholecystokinin A receptor
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000008181    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_000730.1-1478s1c1
Sequence:CCGGGAGGAGGCAGAGAAGAAAGAACTCGAGTTCTTTCTTCTCTGCCTCCTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000008183    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000730.1-790s1c1
Sequence:CCGGCTGTTACTCATCCTCTTTCTTCTCGAGAAGAAAGAGGATGAGTAACAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000008182    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000730.1-562s1c1
Sequence:CCGGCTAGAGAGATATGGTGCGATTCTCGAGAATCGCACCATATCTCTCTAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000011237    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000730.1-282s1c1
Sequence:CCGGGCAGATTCTCTTGTACTCCTTCTCGAGAAGGAGTACAAGAGAATCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000356745    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000730.2-717s21c1
Sequence:CCGGTAACAACCAGACCGCGAATATCTCGAGATATTCGCGGTCTGGTTGTTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000356746    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000730.2-740s21c1
Sequence:CCGGGCCGCTTTCTACTGCCAAATGCTCGAGCATTTGGCAGTAGAAAGCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000356744    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000730.2-539s21c1
Sequence:CCGGCCTTTAATCTGGTAGCCATATCTCGAGATATGGCTACCAGATTAAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000378135    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000730.2-922s21c1
Sequence:CCGGACCACCAGCAGCGGCAAATATCTCGAGATATTTGCCGCTGCTGGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000356805    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000730.2-289s21c1
Sequence:CCGGCTCTTGTACTCCTTGATATTCCTCGAGGAATATCAAGGAGTACAAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_009827
CCKAR MISSION shRNA Bacterial Glycerol Stock
cholecystokinin A receptor
Mouse
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000026659    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009827.1-1563s1c1
Sequence:CCGGCGATGGCTGTTACTTGCAGAACTCGAGTTCTGCAAGTAACAGCCATCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000026649    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_009827.1-3087s1c1
Sequence:CCGGCGTGTGCGTAAACTAAACATACTCGAGTATGTTTAGTTTACGCACACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000026621    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009827.1-1116s1c1
Sequence:CCGGCGTGAGTGTTTCCACCTTCAACTCGAGTTGAAGGTGGAAACACTCACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000026672    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009827.1-1200s1c1
Sequence:CCGGGCAAACAAAGTCCCATGCTTTCTCGAGAAAGCATGGGACTTTGTTTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000444168    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009827.2-1306s21c1
Sequence:CCGGTCCGCATGCTCATTGTCATTGCTCGAGCAATGACAATGAGCATGCGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000416573    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009827.2-1892s21c1
Sequence:CCGGCACTGGGCTCGTGCTACAAATCTCGAGATTTGTAGCACGAGCCCAGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_009827
CCKAR MISSION shRNA shRNA Plasmid DNA
cholecystokinin A receptor
Mouse
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000026659    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009827.1-1563s1c1
Sequence:CCGGCGATGGCTGTTACTTGCAGAACTCGAGTTCTGCAAGTAACAGCCATCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000026649    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_009827.1-3087s1c1
Sequence:CCGGCGTGTGCGTAAACTAAACATACTCGAGTATGTTTAGTTTACGCACACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000026621    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009827.1-1116s1c1
Sequence:CCGGCGTGAGTGTTTCCACCTTCAACTCGAGTTGAAGGTGGAAACACTCACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000026672    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009827.1-1200s1c1
Sequence:CCGGGCAAACAAAGTCCCATGCTTTCTCGAGAAAGCATGGGACTTTGTTTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000444168    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009827.2-1306s21c1
Sequence:CCGGTCCGCATGCTCATTGTCATTGCTCGAGCAATGACAATGAGCATGCGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000416573    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009827.2-1892s21c1
Sequence:CCGGCACTGGGCTCGTGCTACAAATCTCGAGATTTGTAGCACGAGCCCAGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_009827
CCKAR MISSION shRNA Lentiviral Transduction Particles
cholecystokinin A receptor
Mouse
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000026659    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009827.1-1563s1c1
Sequence:CCGGCGATGGCTGTTACTTGCAGAACTCGAGTTCTGCAAGTAACAGCCATCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000026649    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_009827.1-3087s1c1
Sequence:CCGGCGTGTGCGTAAACTAAACATACTCGAGTATGTTTAGTTTACGCACACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000026621    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009827.1-1116s1c1
Sequence:CCGGCGTGAGTGTTTCCACCTTCAACTCGAGTTGAAGGTGGAAACACTCACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000026672    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009827.1-1200s1c1
Sequence:CCGGGCAAACAAAGTCCCATGCTTTCTCGAGAAAGCATGGGACTTTGTTTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000444168    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009827.2-1306s21c1
Sequence:CCGGTCCGCATGCTCATTGTCATTGCTCGAGCAATGACAATGAGCATGCGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000416573    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009827.2-1892s21c1
Sequence:CCGGCACTGGGCTCGTGCTACAAATCTCGAGATTTGTAGCACGAGCCCAGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks