EMAIL THIS PAGE TO A FRIEND

CCKBR

cholecystokinin B receptor

109 Gene Product Result for
Synonyms: CCK-B CCK2R GASR
Gene ID:
Human(887) Summary: This gene encodes a G-protein coupled receptor for gastrin and cholecystokinin (CCK), regulatory peptides of the brain and gastrointestinal tract. This protein is a type B gastrin receptor, which has a high affinity for both sulfated and nonsulfated CCK analogs and is found principally in the central nervous system and the gastrointestinal tract. A misspliced transcript variant including an intron has been observed in cells from colorectal and pancreatic tumors. [provided by RefSeq, Jul 2008]
Mouse(12426) cholecystokinin B receptor
Rat(25706) cholecystokinin B receptor
sheep(101118381) cholecystokinin B receptor
Domestic Rabbit(100328939) cholecystokinin B receptor
naked mole-rat(101698062) cholecystokinin B receptor
domestic guinea pig(100720322) cholecystokinin B receptor
chicken(414885) cholecystokinin B receptor
cow(281665) cholecystokinin B receptor
Horse(100055073) cholecystokinin B receptor
domestic cat(101098743) cholecystokinin B receptor
dog(485333) cholecystokinin B receptor
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_176875 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_176875 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_176875 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_007627 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_007627 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_007627 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_176875 Rosetta Predictions human pricing
NM_013165 Rosetta Predictions rat pricing
NM_007627 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_176875 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00192094 predicted 598
2 SASI_Hs01_00192095 predicted 532
3 SASI_Hs02_00369257 predicted 940
4 SASI_Hs01_00192096 predicted 1583
5 SASI_Hs01_00192097 predicted 313
6 SASI_Hs01_00192099 predicted 964
7 SASI_Hs01_00192100 predicted 753
8 SASI_Hs01_00192101 predicted 905
9 SASI_Hs01_00192103 predicted 338
10 SASI_Hs02_00369258 predicted 355
11 SASI_Hs01_00192098 predicted 1752
12 SASI_Hs01_00192102 predicted 1739
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_013165 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00103480 predicted 604
2 SASI_Rn01_00103481 predicted 206
3 SASI_Rn02_00260988 predicted 1417
4 SASI_Rn01_00103482 predicted 199
5 SASI_Rn01_00103484 predicted 1421
6 SASI_Rn01_00103485 predicted 214
7 SASI_Rn01_00103486 predicted 449
8 SASI_Rn01_00103487 predicted 446
9 SASI_Rn01_00103488 predicted 216
10 SASI_Rn01_00103489 predicted 1418
11 SASI_Rn01_00103483 predicted 1431
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_007627 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00097652 predicted 1330
2 SASI_Mm01_00097653 predicted 1593
3 SASI_Mm01_00097654 predicted 1588
4 SASI_Mm01_00097655 predicted 1643
5 SASI_Mm01_00097656 predicted 1216
6 SASI_Mm01_00097657 predicted 375
7 SASI_Mm01_00097658 predicted 867
8 SASI_Mm01_00097659 predicted 801
9 SASI_Mm01_00097660 predicted 915
10 SASI_Mm01_00097661 predicted 607
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_176875
CCKBR MISSION shRNA Bacterial Glycerol Stock
cholecystokinin B receptor
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000368612    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_176875.2-1225s21c1
Sequence:CCGGGTGTTGGTTGCCAGTTTATAGCTCGAGCTATAAACTGGCAACCAACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000356409    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_176875.2-1793s21c1
Sequence:CCGGGTCCCTAGCAGTGAACTATTTCTCGAGAAATAGTTCACTGCTAGGGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000356410    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_176875.2-355s21c1
Sequence:CCGGGGCCATTAGAATCACTCTTTACTCGAGTAAAGAGTGATTCTAATGGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000356349    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_176875.2-1849s21c1
Sequence:CCGGCTCTCACACACATAGATTAATCTCGAGATTAATCTATGTGTGTGAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000005902    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_176875.2-1792s1c1
Sequence:CCGGCGTCCCTAGCAGTGAACTATTCTCGAGAATAGTTCACTGCTAGGGACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000005903    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_176875.2-1190s1c1
Sequence:CCGGCGAATGTTGCTGGTGATCGTTCTCGAGAACGATCACCAGCAACATTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000005904    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_176875.2-859s1c1
Sequence:CCGGGCTTCTGCTCTTGTTCTTCATCTCGAGATGAAGAACAAGAGCAGAAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000005905    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_176875.2-367s1c1
Sequence:CCGGCACTCTTTACGCAGTGATCTTCTCGAGAAGATCACTGCGTAAAGAGTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_176875
CCKBR MISSION shRNA shRNA Plasmid DNA
cholecystokinin B receptor
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000368612    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_176875.2-1225s21c1
Sequence:CCGGGTGTTGGTTGCCAGTTTATAGCTCGAGCTATAAACTGGCAACCAACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000356409    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_176875.2-1793s21c1
Sequence:CCGGGTCCCTAGCAGTGAACTATTTCTCGAGAAATAGTTCACTGCTAGGGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000356410    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_176875.2-355s21c1
Sequence:CCGGGGCCATTAGAATCACTCTTTACTCGAGTAAAGAGTGATTCTAATGGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000356349    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_176875.2-1849s21c1
Sequence:CCGGCTCTCACACACATAGATTAATCTCGAGATTAATCTATGTGTGTGAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000005902    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_176875.2-1792s1c1
Sequence:CCGGCGTCCCTAGCAGTGAACTATTCTCGAGAATAGTTCACTGCTAGGGACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000005903    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_176875.2-1190s1c1
Sequence:CCGGCGAATGTTGCTGGTGATCGTTCTCGAGAACGATCACCAGCAACATTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000005904    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_176875.2-859s1c1
Sequence:CCGGGCTTCTGCTCTTGTTCTTCATCTCGAGATGAAGAACAAGAGCAGAAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000005905    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_176875.2-367s1c1
Sequence:CCGGCACTCTTTACGCAGTGATCTTCTCGAGAAGATCACTGCGTAAAGAGTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_176875
CCKBR MISSION shRNA Lentiviral Transduction Particles
cholecystokinin B receptor
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000368612    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_176875.2-1225s21c1
Sequence:CCGGGTGTTGGTTGCCAGTTTATAGCTCGAGCTATAAACTGGCAACCAACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000356409    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_176875.2-1793s21c1
Sequence:CCGGGTCCCTAGCAGTGAACTATTTCTCGAGAAATAGTTCACTGCTAGGGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000356410    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_176875.2-355s21c1
Sequence:CCGGGGCCATTAGAATCACTCTTTACTCGAGTAAAGAGTGATTCTAATGGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000356349    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_176875.2-1849s21c1
Sequence:CCGGCTCTCACACACATAGATTAATCTCGAGATTAATCTATGTGTGTGAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000005902    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_176875.2-1792s1c1
Sequence:CCGGCGTCCCTAGCAGTGAACTATTCTCGAGAATAGTTCACTGCTAGGGACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000005903    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_176875.2-1190s1c1
Sequence:CCGGCGAATGTTGCTGGTGATCGTTCTCGAGAACGATCACCAGCAACATTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000005904    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_176875.2-859s1c1
Sequence:CCGGGCTTCTGCTCTTGTTCTTCATCTCGAGATGAAGAACAAGAGCAGAAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000005905    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_176875.2-367s1c1
Sequence:CCGGCACTCTTTACGCAGTGATCTTCTCGAGAAGATCACTGCGTAAAGAGTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_007627
VALIDATED
CCKBR MISSION shRNA Bacterial Glycerol Stock
cholecystokinin B receptor
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000328362    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007627.4-951s21c1
Sequence:CCGGTCCGCTTTGATGGTGATAATGCTCGAGCATTATCACCATCAAAGCGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000271748    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007627.4-1518s21c1
Sequence:CCGGCTCTGTCCAGGCTAAGCTATACTCGAGTATAGCTTAGCCTGGACAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000271772    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007627.4-2126s21c1
Sequence:CCGGCTCACCAGACCACATCATAAACTCGAGTTTATGATGTGGTCTGGTGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000328476    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007627.4-367s21c1
Sequence:CCGGGACCATTCGAATCACCCTTTACTCGAGTAAAGGGTGATTCGAATGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000026663    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007627.2-1338s1c1
Sequence:CCGGCCCTATCTCTTTCATCCACTTCTCGAGAAGTGGATGAAAGAGATAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000026604    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007627.2-839s1c1
Sequence:CCGGCCAGTGAACGTGTCCAACAAACTCGAGTTTGTTGGACACGTTCACTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000026611    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007627.2-394s1c1
Sequence:CCGGGCGGTGATCTTTCTGATGAGTCTCGAGACTCATCAGAAAGATCACCGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000026680    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007627.2-955s1c1
Sequence:CCGGCTCCGCTTTGATGGTGATAATCTCGAGATTATCACCATCAAAGCGGAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000026681    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.51 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007627.2-1807s1c1
Sequence:CCGGCCCATTACATAGACAGACATACTCGAGTATGTCTGTCTATGTAATGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_007627
VALIDATED
CCKBR MISSION shRNA shRNA Plasmid DNA
cholecystokinin B receptor
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000328362    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007627.4-951s21c1
Sequence:CCGGTCCGCTTTGATGGTGATAATGCTCGAGCATTATCACCATCAAAGCGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000271748    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007627.4-1518s21c1
Sequence:CCGGCTCTGTCCAGGCTAAGCTATACTCGAGTATAGCTTAGCCTGGACAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000271772    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007627.4-2126s21c1
Sequence:CCGGCTCACCAGACCACATCATAAACTCGAGTTTATGATGTGGTCTGGTGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000328476    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007627.4-367s21c1
Sequence:CCGGGACCATTCGAATCACCCTTTACTCGAGTAAAGGGTGATTCGAATGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000026663    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007627.2-1338s1c1
Sequence:CCGGCCCTATCTCTTTCATCCACTTCTCGAGAAGTGGATGAAAGAGATAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000026604    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007627.2-839s1c1
Sequence:CCGGCCAGTGAACGTGTCCAACAAACTCGAGTTTGTTGGACACGTTCACTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000026611    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007627.2-394s1c1
Sequence:CCGGGCGGTGATCTTTCTGATGAGTCTCGAGACTCATCAGAAAGATCACCGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000026680    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007627.2-955s1c1
Sequence:CCGGCTCCGCTTTGATGGTGATAATCTCGAGATTATCACCATCAAAGCGGAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000026681    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.51 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007627.2-1807s1c1
Sequence:CCGGCCCATTACATAGACAGACATACTCGAGTATGTCTGTCTATGTAATGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_007627
VALIDATED
CCKBR MISSION shRNA Lentiviral Transduction Particles
cholecystokinin B receptor
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000328362    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007627.4-951s21c1
Sequence:CCGGTCCGCTTTGATGGTGATAATGCTCGAGCATTATCACCATCAAAGCGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000271748    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007627.4-1518s21c1
Sequence:CCGGCTCTGTCCAGGCTAAGCTATACTCGAGTATAGCTTAGCCTGGACAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000271772    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007627.4-2126s21c1
Sequence:CCGGCTCACCAGACCACATCATAAACTCGAGTTTATGATGTGGTCTGGTGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000328476    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007627.4-367s21c1
Sequence:CCGGGACCATTCGAATCACCCTTTACTCGAGTAAAGGGTGATTCGAATGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000026663    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007627.2-1338s1c1
Sequence:CCGGCCCTATCTCTTTCATCCACTTCTCGAGAAGTGGATGAAAGAGATAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000026604    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007627.2-839s1c1
Sequence:CCGGCCAGTGAACGTGTCCAACAAACTCGAGTTTGTTGGACACGTTCACTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000026611    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007627.2-394s1c1
Sequence:CCGGGCGGTGATCTTTCTGATGAGTCTCGAGACTCATCAGAAAGATCACCGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000026680    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007627.2-955s1c1
Sequence:CCGGCTCCGCTTTGATGGTGATAATCTCGAGATTATCACCATCAAAGCGGAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000026681    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.51 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007627.2-1807s1c1
Sequence:CCGGCCCATTACATAGACAGACATACTCGAGTATGTCTGTCTATGTAATGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks