EMAIL THIS PAGE TO A FRIEND

CCL11

chemokine (C-C motif) ligand 11

81 Gene Product Result for
Synonyms: SCYA11
UniProtKB ID: P51671, P50877, Q92490, Q92491
Gene ID:
Human(6356) Summary: This gene is one of several chemokine genes clustered on the q-arm of chromosome 17. Chemokines form a superfamily of secreted proteins involved in immunoregulatory and inflammatory processes. The superfamily is divided into four subfamilies based on the arrangement of two N-terminal cysteine residues of the mature peptide. This chemokine, a member of the CC subfamily, displays chemotactic activity for eosinophils, but not mononuclear cells or neutrophils. This eosinophil-specific chemokine is thought to be involved in eosinophilic inflammatory diseases such as atopic dermatitis, allergic rhinitis, asthma and parasitic infections. [provided by RefSeq, Jul 2013]
Mouse(20292) chemokine (C-C motif) ligand 11
Rat(29397) chemokine (C-C motif) ligand 11
sheep(101119832) chemokine (C-C motif) ligand 11
naked mole-rat(101698865) chemokine (C-C motif) ligand 11
domestic guinea pig(100135493) chemokine (C-C motif) ligand 11
cow(404072) chemokine (C-C motif) ligand 11
Horse(100033949) chemokine (C-C motif) ligand 11
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_002986 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_002986 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_002986 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_011330 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_011330 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_011330 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU151041 MISSION® esiRNA esiRNA human CCL11 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_002986 Rosetta Predictions human pricing
NM_019205 Rosetta Predictions rat pricing
NM_011330 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_002986 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00169965 predicted 229
2 SASI_Hs01_00169966 predicted 288
3 SASI_Hs01_00169967 predicted 265
4 SASI_Hs01_00169968 predicted 206
5 SASI_Hs01_00169969 predicted 282
6 SASI_Hs01_00169970 predicted 230
7 SASI_Hs01_00169971 predicted 234
8 SASI_Hs01_00169972 predicted 281
9 SASI_Hs01_00169973 predicted 272
10 SASI_Hs01_00169974 predicted 242
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_019205 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00037020 predicted 560
2 SASI_Rn01_00037021 predicted 502
3 SASI_Rn02_00262039 predicted 465
4 SASI_Rn01_00037022 predicted 627
5 SASI_Rn01_00037023 predicted 420
6 SASI_Rn01_00037025 predicted 560
7 SASI_Rn01_00037026 predicted 338
8 SASI_Rn01_00037027 predicted 421
9 SASI_Rn01_00037028 predicted 400
10 SASI_Rn01_00037029 predicted 655
11 SASI_Rn01_00037024 predicted 549
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_011330 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00320431 predicted 800
2 SASI_Mm02_00320432 predicted 559
3 SASI_Mm01_00047541 predicted 595
4 SASI_Mm01_00047543 predicted 638
5 SASI_Mm02_00320433 predicted 223
6 SASI_Mm01_00047548 predicted 613
7 SASI_Mm02_00320434 predicted 219
8 SASI_Mm02_00320435 predicted 744
9 SASI_Mm02_00320436 predicted 741
10 SASI_Mm02_00320437 predicted 698
11 SASI_Mm01_00047540 predicted 584
12 SASI_Mm01_00047542 predicted 557
13 SASI_Mm01_00047544 predicted 362
14 SASI_Mm01_00047545 predicted 521
15 SASI_Mm01_00047546 predicted 462
16 SASI_Mm01_00047547 predicted 373
17 SASI_Mm01_00047549 predicted 567
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_002986
CCL11 MISSION shRNA Bacterial Glycerol Stock
chemokine (C-C motif) ligand 11
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000377738    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002986.2-504s21c1
Sequence:CCGGCATTCTGAGGTAACCTCATTACTCGAGTAATGAGGTTACCTCAGAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000371652    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002986.2-619s21c1
Sequence:CCGGTCCTCCATGAATATCAGTTATCTCGAGATAACTGATATTCATGGAGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000371592    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002986.2-418s21c1
Sequence:CCGGCCAACTCCAAAGCCATAAATACTCGAGTATTTATGGCTTTGGAGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000057863    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002986.2-236s1c1
Sequence:CCGGGCTGCTTTAACCTGGCCAATACTCGAGTATTGGCCAGGTTAAAGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000057865    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002986.2-322s1c1
Sequence:CCGGGCTGTGATCTTCAAGACCAAACTCGAGTTTGGTCTTGAAGATCACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000057866    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002986.2-392s1c1
Sequence:CCGGCCATGAAGTATCTGGACCAAACTCGAGTTTGGTCCAGATACTTCATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000057867    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002986.2-276s1c1
Sequence:CCGGACTAGAGAGCTACAGGAGAATCTCGAGATTCTCCTGTAGCTCTCTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000057864    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002986.2-382s1c1
Sequence:CCGGGTGCAGGATTCCATGAAGTATCTCGAGATACTTCATGGAATCCTGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_002986
CCL11 MISSION shRNA shRNA Plasmid DNA
chemokine (C-C motif) ligand 11
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000377738    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002986.2-504s21c1
Sequence:CCGGCATTCTGAGGTAACCTCATTACTCGAGTAATGAGGTTACCTCAGAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000371652    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002986.2-619s21c1
Sequence:CCGGTCCTCCATGAATATCAGTTATCTCGAGATAACTGATATTCATGGAGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000371592    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002986.2-418s21c1
Sequence:CCGGCCAACTCCAAAGCCATAAATACTCGAGTATTTATGGCTTTGGAGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000057863    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002986.2-236s1c1
Sequence:CCGGGCTGCTTTAACCTGGCCAATACTCGAGTATTGGCCAGGTTAAAGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000057865    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002986.2-322s1c1
Sequence:CCGGGCTGTGATCTTCAAGACCAAACTCGAGTTTGGTCTTGAAGATCACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000057866    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002986.2-392s1c1
Sequence:CCGGCCATGAAGTATCTGGACCAAACTCGAGTTTGGTCCAGATACTTCATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000057867    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002986.2-276s1c1
Sequence:CCGGACTAGAGAGCTACAGGAGAATCTCGAGATTCTCCTGTAGCTCTCTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000057864    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002986.2-382s1c1
Sequence:CCGGGTGCAGGATTCCATGAAGTATCTCGAGATACTTCATGGAATCCTGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_002986
CCL11 MISSION shRNA Lentiviral Transduction Particles
chemokine (C-C motif) ligand 11
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000377738    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002986.2-504s21c1
Sequence:CCGGCATTCTGAGGTAACCTCATTACTCGAGTAATGAGGTTACCTCAGAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000371652    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002986.2-619s21c1
Sequence:CCGGTCCTCCATGAATATCAGTTATCTCGAGATAACTGATATTCATGGAGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000371592    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002986.2-418s21c1
Sequence:CCGGCCAACTCCAAAGCCATAAATACTCGAGTATTTATGGCTTTGGAGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000057863    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002986.2-236s1c1
Sequence:CCGGGCTGCTTTAACCTGGCCAATACTCGAGTATTGGCCAGGTTAAAGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000057865    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002986.2-322s1c1
Sequence:CCGGGCTGTGATCTTCAAGACCAAACTCGAGTTTGGTCTTGAAGATCACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000057866    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002986.2-392s1c1
Sequence:CCGGCCATGAAGTATCTGGACCAAACTCGAGTTTGGTCCAGATACTTCATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000057867    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002986.2-276s1c1
Sequence:CCGGACTAGAGAGCTACAGGAGAATCTCGAGATTCTCCTGTAGCTCTCTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000057864    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002986.2-382s1c1
Sequence:CCGGGTGCAGGATTCCATGAAGTATCTCGAGATACTTCATGGAATCCTGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_011330
CCL11 MISSION shRNA Bacterial Glycerol Stock
chemokine (C-C motif) ligand 11
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000067458    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011330.1-206s1c1
Sequence:CCGGCAACAACAGATGCACCCTGAACTCGAGTTCAGGGTGCATCTGTTGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000067459    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011330.1-142s1c1
Sequence:CCGGGCTGCTTTATCATGACCAGTACTCGAGTACTGGTCATGATAAAGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000067461    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011330.1-297s1c1
Sequence:CCGGGCCACAAAGCACCTGGACCAACTCGAGTTGGTCCAGGTGCTTTGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000067462    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011330.1-218s1c1
Sequence:CCGGCACCCTGAAAGCCATAGTCTTCTCGAGAAGACTATGGCTTTCAGGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000067460    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011330.1-176s1c1
Sequence:CCGGCACACTACTGAAGAGCTACAACTCGAGTTGTAGCTCTTCAGTAGTGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_011330
CCL11 MISSION shRNA shRNA Plasmid DNA
chemokine (C-C motif) ligand 11
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000067458    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011330.1-206s1c1
Sequence:CCGGCAACAACAGATGCACCCTGAACTCGAGTTCAGGGTGCATCTGTTGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000067459    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011330.1-142s1c1
Sequence:CCGGGCTGCTTTATCATGACCAGTACTCGAGTACTGGTCATGATAAAGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000067461    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011330.1-297s1c1
Sequence:CCGGGCCACAAAGCACCTGGACCAACTCGAGTTGGTCCAGGTGCTTTGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000067462    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011330.1-218s1c1
Sequence:CCGGCACCCTGAAAGCCATAGTCTTCTCGAGAAGACTATGGCTTTCAGGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000067460    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011330.1-176s1c1
Sequence:CCGGCACACTACTGAAGAGCTACAACTCGAGTTGTAGCTCTTCAGTAGTGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_011330
CCL11 MISSION shRNA Lentiviral Transduction Particles
chemokine (C-C motif) ligand 11
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000067458    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011330.1-206s1c1
Sequence:CCGGCAACAACAGATGCACCCTGAACTCGAGTTCAGGGTGCATCTGTTGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000067459    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011330.1-142s1c1
Sequence:CCGGGCTGCTTTATCATGACCAGTACTCGAGTACTGGTCATGATAAAGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000067461    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011330.1-297s1c1
Sequence:CCGGGCCACAAAGCACCTGGACCAACTCGAGTTGGTCCAGGTGCTTTGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000067462    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011330.1-218s1c1
Sequence:CCGGCACCCTGAAAGCCATAGTCTTCTCGAGAAGACTATGGCTTTCAGGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000067460    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011330.1-176s1c1
Sequence:CCGGCACACTACTGAAGAGCTACAACTCGAGTTGTAGCTCTTCAGTAGTGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks