EMAIL THIS PAGE TO A FRIEND

CCL13

chemokine (C-C motif) ligand 13

31 Gene Product Result for
Synonyms: CKb10 MCP-4 NCC-1 NCC1 SCYA13 SCYL1
UniProtKB ID: Q99616, O95689, Q6ICQ6
Gene ID:
Human(6357) Summary: This gene is one of several Cys-Cys (CC) cytokine genes clustered on the q-arm of chromosome 17. Cytokines are a family of secreted proteins involved in immunoregulatory and inflammatory processes. The CC cytokines are proteins characterized by two adjacent cysteines. The cytokine encoded by this gene displays chemotactic activity for monocytes, lymphocytes, basophils and eosinophils, but not neutrophils. This chemokine plays a role in accumulation of leukocytes during inflammation. It may also be involved in the recruitment of monocytes into the arterial wall during artherosclerosis. [provided by RefSeq, Jul 2008]
dog(445451) chemokine (C-C motif) ligand 13
Horse(100033951) chemokine (C-C motif) ligand 13
domestic cat(101099760) chemokine (C-C motif) ligand 13
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_005408 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_005408 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_005408 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU017861 MISSION® esiRNA esiRNA targeting human CCL13 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_005408 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_005408 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00141141 predicted 538
2 SASI_Hs01_00141142 predicted 208
3 SASI_Hs01_00141143 predicted 307
4 SASI_Hs01_00141144 predicted 598
5 SASI_Hs01_00141145 predicted 266
6 SASI_Hs01_00141146 predicted 596
7 SASI_Hs01_00141147 predicted 347
8 SASI_Hs01_00141148 predicted 451
9 SASI_Hs01_00141149 predicted 342
10 SASI_Hs01_00141150 predicted 509
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_005408
CCL13 MISSION shRNA Bacterial Glycerol Stock
chemokine (C-C motif) ligand 13
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000057943    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005408.2-321s1c1
Sequence:CCGGCCAGAATTATATGAAACACCTCTCGAGAGGTGTTTCATATAATTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000057947    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005408.2-315s1c1
Sequence:CCGGGTGGGTCCAGAATTATATGAACTCGAGTTCATATAATTCTGGACCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000057945    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005408.2-259s1c1
Sequence:CCGGGCTGTCATCTTCAGAACCAAACTCGAGTTTGGTTCTGAAGATGACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000057944    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005408.2-183s1c1
Sequence:CCGGCACATTTAGCAGTAAGAAGATCTCGAGATCTTCTTACTGCTAAATGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000371653    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005408.2-453s21c1
Sequence:CCGGTGGAATACTTCTACCATAATTCTCGAGAATTATGGTAGAAGTATTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000371595    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005408.2-156s21c1
Sequence:CCGGACTCAACGTCCCATCTACTTGCTCGAGCAAGTAGATGGGACGTTGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000371654    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005408.2-394s21c1
Sequence:CCGGTCAAGCTGGAGTACGTGAAATCTCGAGATTTCACGTACTCCAGCTTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_005408
CCL13 MISSION shRNA shRNA Plasmid DNA
chemokine (C-C motif) ligand 13
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000057943    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005408.2-321s1c1
Sequence:CCGGCCAGAATTATATGAAACACCTCTCGAGAGGTGTTTCATATAATTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000057947    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005408.2-315s1c1
Sequence:CCGGGTGGGTCCAGAATTATATGAACTCGAGTTCATATAATTCTGGACCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000057945    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005408.2-259s1c1
Sequence:CCGGGCTGTCATCTTCAGAACCAAACTCGAGTTTGGTTCTGAAGATGACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000057944    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005408.2-183s1c1
Sequence:CCGGCACATTTAGCAGTAAGAAGATCTCGAGATCTTCTTACTGCTAAATGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000371653    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005408.2-453s21c1
Sequence:CCGGTGGAATACTTCTACCATAATTCTCGAGAATTATGGTAGAAGTATTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000371595    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005408.2-156s21c1
Sequence:CCGGACTCAACGTCCCATCTACTTGCTCGAGCAAGTAGATGGGACGTTGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000371654    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005408.2-394s21c1
Sequence:CCGGTCAAGCTGGAGTACGTGAAATCTCGAGATTTCACGTACTCCAGCTTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_005408
CCL13 MISSION shRNA Lentiviral Transduction Particles
chemokine (C-C motif) ligand 13
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000057943    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005408.2-321s1c1
Sequence:CCGGCCAGAATTATATGAAACACCTCTCGAGAGGTGTTTCATATAATTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000057947    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005408.2-315s1c1
Sequence:CCGGGTGGGTCCAGAATTATATGAACTCGAGTTCATATAATTCTGGACCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000057945    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005408.2-259s1c1
Sequence:CCGGGCTGTCATCTTCAGAACCAAACTCGAGTTTGGTTCTGAAGATGACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000057944    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005408.2-183s1c1
Sequence:CCGGCACATTTAGCAGTAAGAAGATCTCGAGATCTTCTTACTGCTAAATGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000371653    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005408.2-453s21c1
Sequence:CCGGTGGAATACTTCTACCATAATTCTCGAGAATTATGGTAGAAGTATTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000371595    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005408.2-156s21c1
Sequence:CCGGACTCAACGTCCCATCTACTTGCTCGAGCAAGTAGATGGGACGTTGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000371654    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005408.2-394s21c1
Sequence:CCGGTCAAGCTGGAGTACGTGAAATCTCGAGATTTCACGTACTCCAGCTTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks