EMAIL THIS PAGE TO A FRIEND

CCL14

chemokine (C-C motif) ligand 14

54 Gene Product Result for
Synonyms: CC-1 CC-3 CKB1 HCC-1 HCC-1(1-74) HCC-1/HCC-3 HCC-3 MCIF NCC-2 NCC2 SCYA14 SCYL2 SY14
UniProtKB ID: Q16627, E1P649, E1P650, Q13954
Gene ID:
Human(6358) Summary: This gene, chemokine (C-C motif) ligand 14, is one of several CC cytokine genes clustered on 17q11.2. The CC cytokines are secreted proteins characterized by two adjacent cysteines. The cytokine encoded by this gene induces changes in intracellular calcium concentration and enzyme release in monocytes. Multiple transcript variants encoding different isoforms have been found for this gene. Read-through transcripts are also expressed that include exons from the upstream cytokine gene, chemokine (C-C motif) ligand 15, and are represented as GeneID: 348249. [provided by RefSeq, Dec 2009]
cow(616723) chemokine (C-C motif) ligand 14
domestic cat(101086016) chemokine (C-C motif) ligand 14
dog(480603) chemokine (C-C motif) ligand 14
naked mole-rat(101713119) chemokine (C-C motif) ligand 14
domestic guinea pig(100735743) chemokine (C-C motif) ligand 14
sheep(101115044) chemokine (C-C motif) ligand 14
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_032963 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_032963 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_032963 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_004166 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_004166 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_004166 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU224511 MISSION® esiRNA esiRNA targeting human CCL14 human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_004166 Rosetta Predictions human pricing
NM_032962 Rosetta Predictions human pricing
NM_032963 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004166 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00055394 predicted 1098
2 SASI_Hs01_00055395 predicted 1056
3 SASI_Hs02_00337031 predicted 1046
4 SASI_Hs02_00337032 predicted 1081
5 SASI_Hs01_00055396 predicted 1083
6 SASI_Hs01_00055397 predicted 1053
7 SASI_Hs02_00337033 predicted 1043
8 SASI_Hs02_00337034 predicted 1099
9 SASI_Hs02_00337035 predicted 1045
10 SASI_Hs01_00055398 predicted 1058
11 SASI_Hs01_00055392 predicted 1126
12 SASI_Hs01_00055393 predicted 1154
13 SASI_Hs01_00055399 predicted 1292
14 SASI_Hs01_00055400 predicted 1221
15 SASI_Hs01_00055401 predicted 1229
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_032962 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00026304 predicted 1000
2 SASI_Hs01_00026305 predicted 1170
3 SASI_Hs01_00026306 predicted 1064
4 SASI_Hs02_00360583 predicted 1067
5 SASI_Hs01_00026307 predicted 1198
6 SASI_Hs01_00026309 predicted 1141
7 SASI_Hs01_00026310 predicted 1100
8 SASI_Hs01_00026311 predicted 1132
9 SASI_Hs01_00026312 predicted 1348
10 SASI_Hs01_00026313 predicted 1331
11 SASI_Hs01_00026308 predicted 1114
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_032963 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00160968 predicted 194
2 SASI_Hs01_00160969 predicted 229
3 SASI_Hs01_00160970 predicted 226
4 SASI_Hs01_00160971 predicted 226
5 SASI_Hs01_00160972 predicted 237
6 SASI_Hs01_00160973 predicted 230
7 SASI_Hs01_00160974 predicted 234
8 SASI_Hs01_00160975 predicted 230
9 SASI_Hs01_00160976 predicted 212
10 SASI_Hs02_00360584 predicted 284
11 SASI_Hs01_00160977 predicted 267
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_032963
CCL14 MISSION shRNA Bacterial Glycerol Stock
chemokine (C-C motif) ligand 14
Human
3 Products Total
TRC Number Price Set Price (3)? Select
TRCN0000377739    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032963.3-207s21c1
Sequence:CCGGAGATCCCGCGTCAGCGGATTACTCGAGTAATCCGCTGACGCGGGATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000371655    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032963.3-130s21c1
Sequence:CCGGCCTAGGGACCAAGACTGAATCCTCGAGGATTCAGTCTTGGTCCCTAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000377682    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032963.3-178s21c1
Sequence:CCGGAGAGTGCTGCTTCACCTACACCTCGAGGTGTAGGTGAAGCAGCACTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_032963
CCL14 MISSION shRNA shRNA Plasmid DNA
chemokine (C-C motif) ligand 14
Human
3 Products Total
TRC Number Vector Price Set Price (3)? Select
TRCN0000377739    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032963.3-207s21c1
Sequence:CCGGAGATCCCGCGTCAGCGGATTACTCGAGTAATCCGCTGACGCGGGATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000371655    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032963.3-130s21c1
Sequence:CCGGCCTAGGGACCAAGACTGAATCCTCGAGGATTCAGTCTTGGTCCCTAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000377682    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032963.3-178s21c1
Sequence:CCGGAGAGTGCTGCTTCACCTACACCTCGAGGTGTAGGTGAAGCAGCACTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_032963
CCL14 MISSION shRNA Lentiviral Transduction Particles
chemokine (C-C motif) ligand 14
Human
3 Products Total
TRC Number Volume Titer Vector Price Set Price (3)? Select
TRCN0000377739    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032963.3-207s21c1
Sequence:CCGGAGATCCCGCGTCAGCGGATTACTCGAGTAATCCGCTGACGCGGGATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000371655    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032963.3-130s21c1
Sequence:CCGGCCTAGGGACCAAGACTGAATCCTCGAGGATTCAGTCTTGGTCCCTAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000377682    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032963.3-178s21c1
Sequence:CCGGAGAGTGCTGCTTCACCTACACCTCGAGGTGTAGGTGAAGCAGCACTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_004166
CCL14 MISSION shRNA Bacterial Glycerol Stock
chemokine (C-C motif) ligand 14
Human
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000057852    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004166.3-1097s1c1
Sequence:CCGGCAAGCCCGGAATTGTCTTCATCTCGAGATGAAGACAATTCCGGGCTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000057851    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004166.3-1028s1c1
Sequence:CCGGCACCTACACTACCTACAAGATCTCGAGATCTTGTAGGTAGTGTAGGTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000057850    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004166.3-1103s1c1
Sequence:CCGGCGGAATTGTCTTCATCACCAACTCGAGTTGGTGATGAAGACAATTCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000057848    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004166.3-1166s1c1
Sequence:CCGGCCAGGACTATATCAAGGACATCTCGAGATGTCCTTGATATAGTCCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_004166
CCL14 MISSION shRNA shRNA Plasmid DNA
chemokine (C-C motif) ligand 14
Human
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000057852    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004166.3-1097s1c1
Sequence:CCGGCAAGCCCGGAATTGTCTTCATCTCGAGATGAAGACAATTCCGGGCTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000057851    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004166.3-1028s1c1
Sequence:CCGGCACCTACACTACCTACAAGATCTCGAGATCTTGTAGGTAGTGTAGGTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000057850    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004166.3-1103s1c1
Sequence:CCGGCGGAATTGTCTTCATCACCAACTCGAGTTGGTGATGAAGACAATTCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000057848    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004166.3-1166s1c1
Sequence:CCGGCCAGGACTATATCAAGGACATCTCGAGATGTCCTTGATATAGTCCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_004166
CCL14 MISSION shRNA Lentiviral Transduction Particles
chemokine (C-C motif) ligand 14
Human
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000057852    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004166.3-1097s1c1
Sequence:CCGGCAAGCCCGGAATTGTCTTCATCTCGAGATGAAGACAATTCCGGGCTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000057851    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004166.3-1028s1c1
Sequence:CCGGCACCTACACTACCTACAAGATCTCGAGATCTTGTAGGTAGTGTAGGTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000057850    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004166.3-1103s1c1
Sequence:CCGGCGGAATTGTCTTCATCACCAACTCGAGTTGGTGATGAAGACAATTCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000057848    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004166.3-1166s1c1
Sequence:CCGGCCAGGACTATATCAAGGACATCTCGAGATGTCCTTGATATAGTCCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)