EMAIL THIS PAGE TO A FRIEND

CCL15

chemokine (C-C motif) ligand 15

57 Gene Product Result for
Synonyms: HCC-2 HMRP-2B LKN-1 LKN1 MIP-1 delta MIP-1D MIP-5 MRP-2B NCC-3 NCC3 SCYA15 SCYL3 SY15
Species: Human CCL15(6359)
UniProtKB ID: Q16663, B2RU34, E1P651, Q9UM74
Gene ID:
Human(6359) Summary: This gene is located in a cluster of similar genes in the same region of chromosome 17. These genes encode CC cytokines, which are secreted proteins characterized by two adjacent cysteines. The product of this gene is chemotactic for T cells and monocytes, and acts through C-C chemokine receptor type 1 (CCR1). The proprotein is further processed into numerous smaller functional peptides. Naturally-occurring readthrough transcripts occur from this gene into the downstream gene, CCL14 (chemokine (C-C motif) ligand 14). [provided by RefSeq, Jan 2013]
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_004167 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_004167 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_004167 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_032965 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_032965 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_032965 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU114531 MISSION® esiRNA esiRNA human CCL15 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_004167 Rosetta Predictions human pricing
NM_032964 Rosetta Predictions human pricing
NM_032965 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004167 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00187656 predicted 590
2 SASI_Hs02_00337036 predicted 520
3 SASI_Hs01_00187661 predicted 607
4 SASI_Hs01_00187662 predicted 495
5 SASI_Hs02_00337037 predicted 629
6 SASI_Hs01_00187663 predicted 605
7 SASI_Hs02_00337038 predicted 525
8 SASI_Hs02_00337039 predicted 525
9 SASI_Hs02_00337040 predicted 502
10 SASI_Hs02_00337041 predicted 592
11 SASI_Hs01_00187657 predicted 709
12 SASI_Hs01_00187658 predicted 776
13 SASI_Hs01_00187659 predicted 768
14 SASI_Hs01_00187660 predicted 633
15 SASI_Hs01_00187664 predicted 760
16 SASI_Hs01_00187665 predicted 771
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_032964 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00228452 predicted 594
2 SASI_Hs02_00360585 predicted 527
3 SASI_Hs01_00228457 predicted 601
4 SASI_Hs01_00228458 predicted 499
5 SASI_Hs02_00360586 predicted 625
6 SASI_Hs01_00228459 predicted 602
7 SASI_Hs02_00360587 predicted 531
8 SASI_Hs02_00360588 predicted 532
9 SASI_Hs02_00360589 predicted 505
10 SASI_Hs02_00360590 predicted 590
11 SASI_Hs01_00228453 predicted 710
12 SASI_Hs01_00228454 predicted 769
13 SASI_Hs01_00228455 predicted 771
14 SASI_Hs01_00228456 predicted 639
15 SASI_Hs01_00228460 predicted 760
16 SASI_Hs01_00228461 predicted 775
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_032965 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00056000 predicted 591
2 SASI_Hs01_00056001 predicted 523
3 SASI_Hs01_00056003 predicted 601
4 SASI_Hs01_00056004 predicted 494
5 SASI_Hs01_00056005 predicted 630
6 SASI_Hs01_00056006 predicted 606
7 SASI_Hs01_00056007 predicted 523
8 SASI_Hs01_00056008 predicted 527
9 SASI_Hs01_00056009 predicted 503
10 SASI_Hs02_00360591 predicted 594
11 SASI_Hs01_00056002 predicted 640
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_004167
CCL15 MISSION shRNA Bacterial Glycerol Stock
chemokine (C-C motif) ligand 15
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000057883    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004167.3-595s1c1
Sequence:CCGGCCAGTAGTTCTGAACAGCTTTCTCGAGAAAGCTGTTCAGAACTACTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000057884    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004167.3-635s1c1
Sequence:CCGGGCACCTCCTACATCTCACAAACTCGAGTTTGTGAGATGTAGGAGGTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000057885    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004167.3-535s1c1
Sequence:CCGGGCCCAGTTCATAAATGATGCACTCGAGTGCATCATTTATGAACTGGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000057887    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004167.3-770s1c1
Sequence:CCGGCGGGAGTTCAGGATTGCATGACTCGAGTCATGCAATCCTGAACTCCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000057886    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004167.3-795s1c1
Sequence:CCGGGCTGAAGCCCTACTCAATATACTCGAGTATATTGAGTAGGGCTTCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_004167
CCL15 MISSION shRNA shRNA Plasmid DNA
chemokine (C-C motif) ligand 15
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000057883    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004167.3-595s1c1
Sequence:CCGGCCAGTAGTTCTGAACAGCTTTCTCGAGAAAGCTGTTCAGAACTACTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000057884    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004167.3-635s1c1
Sequence:CCGGGCACCTCCTACATCTCACAAACTCGAGTTTGTGAGATGTAGGAGGTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000057885    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004167.3-535s1c1
Sequence:CCGGGCCCAGTTCATAAATGATGCACTCGAGTGCATCATTTATGAACTGGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000057887    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004167.3-770s1c1
Sequence:CCGGCGGGAGTTCAGGATTGCATGACTCGAGTCATGCAATCCTGAACTCCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000057886    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004167.3-795s1c1
Sequence:CCGGGCTGAAGCCCTACTCAATATACTCGAGTATATTGAGTAGGGCTTCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_004167
CCL15 MISSION shRNA Lentiviral Transduction Particles
chemokine (C-C motif) ligand 15
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000057883    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004167.3-595s1c1
Sequence:CCGGCCAGTAGTTCTGAACAGCTTTCTCGAGAAAGCTGTTCAGAACTACTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000057884    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004167.3-635s1c1
Sequence:CCGGGCACCTCCTACATCTCACAAACTCGAGTTTGTGAGATGTAGGAGGTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000057885    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004167.3-535s1c1
Sequence:CCGGGCCCAGTTCATAAATGATGCACTCGAGTGCATCATTTATGAACTGGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000057887    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004167.3-770s1c1
Sequence:CCGGCGGGAGTTCAGGATTGCATGACTCGAGTCATGCAATCCTGAACTCCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000057886    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004167.3-795s1c1
Sequence:CCGGGCTGAAGCCCTACTCAATATACTCGAGTATATTGAGTAGGGCTTCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_032965
CCL15 MISSION shRNA Bacterial Glycerol Stock
chemokine (C-C motif) ligand 15
Human
3 Products Total
TRC Number Price Set Price (3)? Select
TRCN0000377734    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032965.3-753s21c1
Sequence:CCGGATCCCGTGTTCACTCATGAAACTCGAGTTTCATGAGTGAACACGGGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000371599    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032965.3-654s21c1
Sequence:CCGGACAGAGTTAATGATGTCAAAGCTCGAGCTTTGACATCATTAACTCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000377741    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032965.3-802s21c1
Sequence:CCGGCCAAGCCAGGTGTCATATTCCCTCGAGGGAATATGACACCTGGCTTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_032965
CCL15 MISSION shRNA shRNA Plasmid DNA
chemokine (C-C motif) ligand 15
Human
3 Products Total
TRC Number Vector Price Set Price (3)? Select
TRCN0000377734    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032965.3-753s21c1
Sequence:CCGGATCCCGTGTTCACTCATGAAACTCGAGTTTCATGAGTGAACACGGGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000371599    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032965.3-654s21c1
Sequence:CCGGACAGAGTTAATGATGTCAAAGCTCGAGCTTTGACATCATTAACTCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000377741    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032965.3-802s21c1
Sequence:CCGGCCAAGCCAGGTGTCATATTCCCTCGAGGGAATATGACACCTGGCTTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_032965
CCL15 MISSION shRNA Lentiviral Transduction Particles
chemokine (C-C motif) ligand 15
Human
3 Products Total
TRC Number Volume Titer Vector Price Set Price (3)? Select
TRCN0000377734    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032965.3-753s21c1
Sequence:CCGGATCCCGTGTTCACTCATGAAACTCGAGTTTCATGAGTGAACACGGGATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000371599    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032965.3-654s21c1
Sequence:CCGGACAGAGTTAATGATGTCAAAGCTCGAGCTTTGACATCATTAACTCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000377741    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032965.3-802s21c1
Sequence:CCGGCCAAGCCAGGTGTCATATTCCCTCGAGGGAATATGACACCTGGCTTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)