EMAIL THIS PAGE TO A FRIEND

CCL16

chemokine (C-C motif) ligand 16

30 Gene Product Result for
Synonyms: CKb12 HCC-4 ILINCK LCC-1 LEC LMC Mtn-1 NCC-4 NCC4 SCYA16 SCYL4
UniProtKB ID: O15467, Q4KKU0
Gene ID:
Human(6360) Summary: This gene is one of several cytokine genes clustered on the q-arm of chromosome 17. Cytokines are a family of secreted proteins involved in immunoregulatory and inflammatory processes. The CC cytokines are proteins characterized by two adjacent cysteines. The cytokine encoded by this gene displays chemotactic activity for lymphocytes and monocytes but not for neutrophils. This cytokine also shows a potent myelosuppressive activity and suppresses proliferation of myeloid progenitor cells. The expression of this gene is upregulated by IL-10. [provided by RefSeq, Jul 2008]
cow(616732) chemokine (C-C motif) ligand 16
dog(480604) chemokine (C-C motif) ligand 16
sheep(101115290) chemokine (C-C motif) ligand 16
domestic guinea pig(100736203) chemokine (C-C motif) ligand 16
naked mole-rat(101712740) chemokine (C-C motif) ligand 16
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_004590 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_004590 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_004590 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_004590 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004590 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00086770 predicted 353
2 SASI_Hs01_00086771 predicted 356
3 SASI_Hs01_00086772 predicted 229
4 SASI_Hs01_00086773 predicted 203
5 SASI_Hs01_00086774 predicted 410
6 SASI_Hs01_00086775 predicted 248
7 SASI_Hs01_00086776 predicted 303
8 SASI_Hs01_00086777 predicted 230
9 SASI_Hs01_00086778 predicted 274
10 SASI_Hs01_00086779 predicted 356
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_004590
CCL16 MISSION shRNA Bacterial Glycerol Stock
chemokine (C-C motif) ligand 16
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000417360    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004590.2-224s21c1
Sequence:CCGGGGATACAGAAAGGCCCTCAACCTCGAGGTTGAGGGCCTTTCTGTATCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000417151    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004590.2-556s21c1
Sequence:CCGGAGGAGAAGTATTTCGAATATTCTCGAGAATATTCGAAATACTTCTCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000057916    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004590.2-178s1c1
Sequence:CCGGCTGCCTGAAGTATTATGAGAACTCGAGTTCTCATAATACTTCAGGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000057915    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004590.2-362s1c1
Sequence:CCGGAGGAACTTGTCCACGGTTAAACTCGAGTTTAACCGTGGACAAGTTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000057917    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004590.2-322s1c1
Sequence:CCGGAGAGTACATCAAGGATCCCAACTCGAGTTGGGATCCTTGATGTACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000057914    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004590.2-262s1c1
Sequence:CCGGCATCTTCGTCACCAAGAGGAACTCGAGTTCCTCTTGGTGACGAAGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000057913    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004590.2-108s1c1
Sequence:CCGGTCCTTATCATTACTTCGGCTTCTCGAGAAGCCGAAGTAATGATAAGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_004590
CCL16 MISSION shRNA shRNA Plasmid DNA
chemokine (C-C motif) ligand 16
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000417360    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004590.2-224s21c1
Sequence:CCGGGGATACAGAAAGGCCCTCAACCTCGAGGTTGAGGGCCTTTCTGTATCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000417151    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004590.2-556s21c1
Sequence:CCGGAGGAGAAGTATTTCGAATATTCTCGAGAATATTCGAAATACTTCTCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000057916    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004590.2-178s1c1
Sequence:CCGGCTGCCTGAAGTATTATGAGAACTCGAGTTCTCATAATACTTCAGGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000057915    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004590.2-362s1c1
Sequence:CCGGAGGAACTTGTCCACGGTTAAACTCGAGTTTAACCGTGGACAAGTTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000057917    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004590.2-322s1c1
Sequence:CCGGAGAGTACATCAAGGATCCCAACTCGAGTTGGGATCCTTGATGTACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000057914    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004590.2-262s1c1
Sequence:CCGGCATCTTCGTCACCAAGAGGAACTCGAGTTCCTCTTGGTGACGAAGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000057913    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004590.2-108s1c1
Sequence:CCGGTCCTTATCATTACTTCGGCTTCTCGAGAAGCCGAAGTAATGATAAGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_004590
CCL16 MISSION shRNA Lentiviral Transduction Particles
chemokine (C-C motif) ligand 16
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000417360    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004590.2-224s21c1
Sequence:CCGGGGATACAGAAAGGCCCTCAACCTCGAGGTTGAGGGCCTTTCTGTATCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000417151    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004590.2-556s21c1
Sequence:CCGGAGGAGAAGTATTTCGAATATTCTCGAGAATATTCGAAATACTTCTCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000057916    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004590.2-178s1c1
Sequence:CCGGCTGCCTGAAGTATTATGAGAACTCGAGTTCTCATAATACTTCAGGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000057915    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004590.2-362s1c1
Sequence:CCGGAGGAACTTGTCCACGGTTAAACTCGAGTTTAACCGTGGACAAGTTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000057917    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004590.2-322s1c1
Sequence:CCGGAGAGTACATCAAGGATCCCAACTCGAGTTGGGATCCTTGATGTACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000057914    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004590.2-262s1c1
Sequence:CCGGCATCTTCGTCACCAAGAGGAACTCGAGTTCCTCTTGGTGACGAAGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000057913    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004590.2-108s1c1
Sequence:CCGGTCCTTATCATTACTTCGGCTTCTCGAGAAGCCGAAGTAATGATAAGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks