EMAIL THIS PAGE TO A FRIEND

CCL17

chemokine (C-C motif) ligand 17

52 Gene Product Result for
Synonyms: A-152E5.3 ABCD-2 SCYA17 TARC
UniProtKB ID: Q92583, A0N0Q9, Q2M287
Gene ID:
Human(6361) Summary: This gene is one of several Cys-Cys (CC) cytokine genes clustered on the q arm of chromosome 16. Cytokines are a family of secreted proteins involved in immunoregulatory and inflammatory processes. The CC cytokines are proteins characterized by two adjacent cysteines. The cytokine encoded by this gene displays chemotactic activity for T lymphocytes, but not monocytes or granulocytes. The product of this gene binds to chemokine receptors CCR4 and CCR8. This chemokine plays important roles in T cell development in thymus as well as in trafficking and activation of mature T cells. [provided by RefSeq, Jul 2008]
Mouse(20295) chemokine (C-C motif) ligand 17
Rat(117518) chemokine (C-C motif) ligand 17
naked mole-rat(101697698) chemokine (C-C motif) ligand 17
domestic guinea pig(100715805) chemokine (C-C motif) ligand 17
sheep(101120186) chemokine (C-C motif) ligand 17
chicken(415652) chemokine (C-C motif) ligand 17
cow(100140488) chemokine (C-C motif) ligand 17
domestic cat(493832) chemokine (C-C motif) ligand 17
dog(403586) chemokine (C-C motif) ligand 17
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_002987 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_002987 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_002987 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_011332 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_011332 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_011332 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_002987 Rosetta Predictions human pricing
NM_057151 Rosetta Predictions rat pricing
NM_011332 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_002987 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00047065 predicted 363
2 SASI_Hs01_00047066 predicted 298
3 SASI_Hs01_00047067 predicted 362
4 SASI_Hs01_00047068 predicted 392
5 SASI_Hs01_00047069 predicted 375
6 SASI_Hs01_00047070 predicted 381
7 SASI_Hs02_00334863 predicted 356
8 SASI_Hs01_00047071 predicted 371
9 SASI_Hs01_00047072 predicted 359
10 SASI_Hs01_00047074 predicted 362
11 SASI_Hs01_00047073 predicted 376
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_057151 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00040062 predicted 89
2 SASI_Rn01_00040063 predicted 191
3 SASI_Rn02_00267108 predicted 239
4 SASI_Rn01_00040064 predicted 169
5 SASI_Rn01_00040065 predicted 82
6 SASI_Rn01_00040066 predicted 174
7 SASI_Rn01_00040067 predicted 133
8 SASI_Rn02_00267109 predicted 225
9 SASI_Rn01_00040068 predicted 161
10 SASI_Rn01_00040069 predicted 71
11 SASI_Rn01_00040070 predicted 92
12 SASI_Rn01_00040071 predicted 63
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_011332 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00149367 predicted 208
2 SASI_Mm01_00149368 predicted 205
3 SASI_Mm01_00149369 predicted 218
4 SASI_Mm01_00149370 predicted 344
5 SASI_Mm01_00149371 predicted 306
6 SASI_Mm01_00149372 predicted 119
7 SASI_Mm01_00149373 predicted 154
8 SASI_Mm01_00149374 predicted 165
9 SASI_Mm01_00149375 predicted 344
10 SASI_Mm01_00149376 predicted 305
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_002987
CCL17 MISSION shRNA Bacterial Glycerol Stock
chemokine (C-C motif) ligand 17
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000058049    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002987.2-382s1c1
Sequence:CCGGGTTAAATACCTGCAAAGCCTTCTCGAGAAGGCTTTGCAGGTATTTAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000058048    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_002987.2-434s1c1
Sequence:CCGGCCTGACTGTCTCCCGGGACTACTCGAGTAGTCCCGGGAGACAGTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000058052    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002987.2-257s1c1
Sequence:CCGGCCCTTAGAAAGCTGAAGACGTCTCGAGACGTCTTCAGCTTTCTAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000058050    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002987.2-235s1c1
Sequence:CCGGGAGTACTTCAAGGGAGCCATTCTCGAGAATGGCTCCCTTGAAGTACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000058051    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002987.2-366s1c1
Sequence:CCGGGAGAGTGAAGAATGCAGTTAACTCGAGTTAACTGCATTCTTCACTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000377742    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002987.2-279s21c1
Sequence:CCGGGTACCAGACATCTGAGGACTGCTCGAGCAGTCCTCAGATGTCTGGTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000371659    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002987.2-393s21c1
Sequence:CCGGGCAAAGCCTTGAGAGGTCTTGCTCGAGCAAGACCTCTCAAGGCTTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000371660    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002987.2-374s21c1
Sequence:CCGGAGAATGCAGTTAAATACCTGCCTCGAGGCAGGTATTTAACTGCATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000371661    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002987.2-299s21c1
Sequence:CCGGGCTCCAGGGATGCCATCGTTTCTCGAGAAACGATGGCATCCCTGGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_002987
CCL17 MISSION shRNA shRNA Plasmid DNA
chemokine (C-C motif) ligand 17
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000058049    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002987.2-382s1c1
Sequence:CCGGGTTAAATACCTGCAAAGCCTTCTCGAGAAGGCTTTGCAGGTATTTAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000058048    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_002987.2-434s1c1
Sequence:CCGGCCTGACTGTCTCCCGGGACTACTCGAGTAGTCCCGGGAGACAGTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000058052    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002987.2-257s1c1
Sequence:CCGGCCCTTAGAAAGCTGAAGACGTCTCGAGACGTCTTCAGCTTTCTAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000058050    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002987.2-235s1c1
Sequence:CCGGGAGTACTTCAAGGGAGCCATTCTCGAGAATGGCTCCCTTGAAGTACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000058051    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002987.2-366s1c1
Sequence:CCGGGAGAGTGAAGAATGCAGTTAACTCGAGTTAACTGCATTCTTCACTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000377742    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002987.2-279s21c1
Sequence:CCGGGTACCAGACATCTGAGGACTGCTCGAGCAGTCCTCAGATGTCTGGTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000371659    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002987.2-393s21c1
Sequence:CCGGGCAAAGCCTTGAGAGGTCTTGCTCGAGCAAGACCTCTCAAGGCTTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000371660    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002987.2-374s21c1
Sequence:CCGGAGAATGCAGTTAAATACCTGCCTCGAGGCAGGTATTTAACTGCATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000371661    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002987.2-299s21c1
Sequence:CCGGGCTCCAGGGATGCCATCGTTTCTCGAGAAACGATGGCATCCCTGGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_002987
CCL17 MISSION shRNA Lentiviral Transduction Particles
chemokine (C-C motif) ligand 17
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000058049    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002987.2-382s1c1
Sequence:CCGGGTTAAATACCTGCAAAGCCTTCTCGAGAAGGCTTTGCAGGTATTTAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000058048    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_002987.2-434s1c1
Sequence:CCGGCCTGACTGTCTCCCGGGACTACTCGAGTAGTCCCGGGAGACAGTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000058052    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002987.2-257s1c1
Sequence:CCGGCCCTTAGAAAGCTGAAGACGTCTCGAGACGTCTTCAGCTTTCTAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000058050    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002987.2-235s1c1
Sequence:CCGGGAGTACTTCAAGGGAGCCATTCTCGAGAATGGCTCCCTTGAAGTACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000058051    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002987.2-366s1c1
Sequence:CCGGGAGAGTGAAGAATGCAGTTAACTCGAGTTAACTGCATTCTTCACTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000377742    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002987.2-279s21c1
Sequence:CCGGGTACCAGACATCTGAGGACTGCTCGAGCAGTCCTCAGATGTCTGGTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000371659    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002987.2-393s21c1
Sequence:CCGGGCAAAGCCTTGAGAGGTCTTGCTCGAGCAAGACCTCTCAAGGCTTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000371660    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002987.2-374s21c1
Sequence:CCGGAGAATGCAGTTAAATACCTGCCTCGAGGCAGGTATTTAACTGCATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000371661    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002987.2-299s21c1
Sequence:CCGGGCTCCAGGGATGCCATCGTTTCTCGAGAAACGATGGCATCCCTGGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_011332
CCL17 MISSION shRNA Bacterial Glycerol Stock
chemokine (C-C motif) ligand 17
Mouse
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000067558    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011332.2-166s1c1
Sequence:CCGGAGGAAGTTGGTGAGCTGGTATCTCGAGATACCAGCTCACCAACTTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000067561    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011332.2-260s1c1
Sequence:CCGGCCAAAGACAAACATGTGAAGACTCGAGTCTTCACATGTTTGTCTTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000067560    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011332.2-123s1c1
Sequence:CCGGCCGAGAGTGCTGCCTGGATTACTCGAGTAATCCAGGCAGCACTCTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000067559    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011332.2-279s1c1
Sequence:CCGGGAAGGCCATCAGATTGGTGAACTCGAGTTCACCAATCTGATGGCCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_011332
CCL17 MISSION shRNA shRNA Plasmid DNA
chemokine (C-C motif) ligand 17
Mouse
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000067558    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011332.2-166s1c1
Sequence:CCGGAGGAAGTTGGTGAGCTGGTATCTCGAGATACCAGCTCACCAACTTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000067561    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011332.2-260s1c1
Sequence:CCGGCCAAAGACAAACATGTGAAGACTCGAGTCTTCACATGTTTGTCTTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000067560    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011332.2-123s1c1
Sequence:CCGGCCGAGAGTGCTGCCTGGATTACTCGAGTAATCCAGGCAGCACTCTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000067559    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011332.2-279s1c1
Sequence:CCGGGAAGGCCATCAGATTGGTGAACTCGAGTTCACCAATCTGATGGCCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_011332
CCL17 MISSION shRNA Lentiviral Transduction Particles
chemokine (C-C motif) ligand 17
Mouse
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000067558    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011332.2-166s1c1
Sequence:CCGGAGGAAGTTGGTGAGCTGGTATCTCGAGATACCAGCTCACCAACTTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000067561    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011332.2-260s1c1
Sequence:CCGGCCAAAGACAAACATGTGAAGACTCGAGTCTTCACATGTTTGTCTTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000067560    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011332.2-123s1c1
Sequence:CCGGCCGAGAGTGCTGCCTGGATTACTCGAGTAATCCAGGCAGCACTCTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000067559    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011332.2-279s1c1
Sequence:CCGGGAAGGCCATCAGATTGGTGAACTCGAGTTCACCAATCTGATGGCCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks