EMAIL THIS PAGE TO A FRIEND

CCL18

chemokine (C-C motif) ligand 18 (pulmonary and activation-regulated)

26 Gene Product Result for
Synonyms: AMAC-1 AMAC1 CKb7 DC-CK1 DCCK1 MIP-4 PARC SCYA18
Species: Human CCL18(6362)
UniProtKB ID: P55774, B5BUM2, Q53X71
Gene ID:
Human(6362) Summary: This gene is one of several Cys-Cys (CC) cytokine genes clustered on the q arm of chromosome 17. Cytokines are a family of secreted proteins involved in immunoregulatory and inflammatory processes. The CC cytokines are proteins characterized by two adjacent cysteines. The cytokine encoded by this gene displays chemotactic activity for naive T cells, CD4+ and CD8+ T cells and nonactivated lymphocytes, but not for monocytes or granulocytes. This chemokine attracts naive T lymphocytes toward dendritic cells and activated macrophages in lymph nodes. It may play a role in both humoral and cell-mediated immunity responses. [provided by RefSeq, Jul 2008]
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_002988 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_002988 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_002988 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU129601 MISSION® esiRNA esiRNA human CCL18 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_002988 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_002988 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00116551 predicted 228
2 SASI_Hs01_00116552 predicted 470
3 SASI_Hs01_00116553 predicted 461
4 SASI_Hs01_00116554 predicted 456
5 SASI_Hs01_00116555 predicted 509
6 SASI_Hs01_00116556 predicted 420
7 SASI_Hs01_00116557 predicted 460
8 SASI_Hs01_00116558 predicted 452
9 SASI_Hs01_00116559 predicted 302
10 SASI_Hs02_00334864 predicted 423
11 SASI_Hs01_00116550 predicted 441
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_002988
CCL18 MISSION shRNA Bacterial Glycerol Stock
chemokine (C-C motif) ligand 18 (pulmonary and activation-regulated)
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000371662    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002988.2-157s21c1
Sequence:CCGGGTCTATACCTCCTGGCAGATTCTCGAGAATCTGCCAGGAGGTATAGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000371601    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002988.2-515s21c1
Sequence:CCGGTCTATTGTTGAGCTGCATTATCTCGAGATAATGCAGCTCAACAATAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000371602    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002988.2-594s21c1
Sequence:CCGGCCTTCAACTCTTCGTACATTCCTCGAGGAATGTACGAAGAGTTGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000057953    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002988.2-279s1c1
Sequence:CCGGCAATAAGAAGTGGGTCCAGAACTCGAGTTCTGGACCCACTTCTTATTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000057956    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002988.2-186s1c1
Sequence:CCGGGTTCATAGTTGACTATTCTGACTCGAGTCAGAATAGTCAACTATGAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000057957    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002988.2-113s1c1
Sequence:CCGGGCTCCTGTGCACAAGTTGGTACTCGAGTACCAACTTGTGCACAGGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000057955    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002988.2-297s1c1
Sequence:CCGGGAAATACATCAGCGACCTGAACTCGAGTTCAGGTCGCTGATGTATTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000057954    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002988.2-121s1c1
Sequence:CCGGGCACAAGTTGGTACCAACAAACTCGAGTTTGTTGGTACCAACTTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_002988
CCL18 MISSION shRNA shRNA Plasmid DNA
chemokine (C-C motif) ligand 18 (pulmonary and activation-regulated)
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000371662    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002988.2-157s21c1
Sequence:CCGGGTCTATACCTCCTGGCAGATTCTCGAGAATCTGCCAGGAGGTATAGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000371601    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002988.2-515s21c1
Sequence:CCGGTCTATTGTTGAGCTGCATTATCTCGAGATAATGCAGCTCAACAATAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000371602    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002988.2-594s21c1
Sequence:CCGGCCTTCAACTCTTCGTACATTCCTCGAGGAATGTACGAAGAGTTGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000057953    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002988.2-279s1c1
Sequence:CCGGCAATAAGAAGTGGGTCCAGAACTCGAGTTCTGGACCCACTTCTTATTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000057956    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002988.2-186s1c1
Sequence:CCGGGTTCATAGTTGACTATTCTGACTCGAGTCAGAATAGTCAACTATGAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000057957    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002988.2-113s1c1
Sequence:CCGGGCTCCTGTGCACAAGTTGGTACTCGAGTACCAACTTGTGCACAGGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000057955    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002988.2-297s1c1
Sequence:CCGGGAAATACATCAGCGACCTGAACTCGAGTTCAGGTCGCTGATGTATTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000057954    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002988.2-121s1c1
Sequence:CCGGGCACAAGTTGGTACCAACAAACTCGAGTTTGTTGGTACCAACTTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_002988
CCL18 MISSION shRNA Lentiviral Transduction Particles
chemokine (C-C motif) ligand 18 (pulmonary and activation-regulated)
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000371662    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002988.2-157s21c1
Sequence:CCGGGTCTATACCTCCTGGCAGATTCTCGAGAATCTGCCAGGAGGTATAGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000371601    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002988.2-515s21c1
Sequence:CCGGTCTATTGTTGAGCTGCATTATCTCGAGATAATGCAGCTCAACAATAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000371602    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002988.2-594s21c1
Sequence:CCGGCCTTCAACTCTTCGTACATTCCTCGAGGAATGTACGAAGAGTTGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000057953    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002988.2-279s1c1
Sequence:CCGGCAATAAGAAGTGGGTCCAGAACTCGAGTTCTGGACCCACTTCTTATTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000057956    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002988.2-186s1c1
Sequence:CCGGGTTCATAGTTGACTATTCTGACTCGAGTCAGAATAGTCAACTATGAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000057957    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002988.2-113s1c1
Sequence:CCGGGCTCCTGTGCACAAGTTGGTACTCGAGTACCAACTTGTGCACAGGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000057955    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002988.2-297s1c1
Sequence:CCGGGAAATACATCAGCGACCTGAACTCGAGTTCAGGTCGCTGATGTATTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000057954    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002988.2-121s1c1
Sequence:CCGGGCACAAGTTGGTACCAACAAACTCGAGTTTGTTGGTACCAACTTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks