EMAIL THIS PAGE TO A FRIEND

CCL19

chemokine (C-C motif) ligand 19

84 Gene Product Result for
Synonyms: CKb11 ELC MIP-3b MIP3B SCYA19
UniProtKB ID: Q99731, O00697, O00736
Gene ID:
Human(6363) Summary: This gene is one of several CC cytokine genes clustered on the p-arm of chromosome 9. Cytokines are a family of secreted proteins involved in immunoregulatory and inflammatory processes. The CC cytokines are proteins characterized by two adjacent cysteines. The cytokine encoded by this gene may play a role in normal lymphocyte recirculation and homing. It also plays an important role in trafficking of T cells in thymus, and in T cell and B cell migration to secondary lymphoid organs. It specifically binds to chemokine receptor CCR7. [provided by RefSeq, Jul 2008]
Mouse(24047) chemokine (C-C motif) ligand 19
Rat(362506) chemokine (C-C motif) ligand 19
chicken(427406) chemokine (C-C motif) ligand 19
dog(448793) chemokine (C-C motif) ligand 19
domestic cat(101087015) chemokine (C-C motif) ligand 19
cow(509167) chemokine (C-C motif) ligand 19
sheep(101120217) chemokine (C-C motif) ligand 19
domestic guinea pig(100723457) chemokine (C-C motif) ligand 19
naked mole-rat(101712542) chemokine (C-C motif) ligand 19
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_006274 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_006274 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_006274 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_011888 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_011888 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_011888 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU013961 MISSION® esiRNA esiRNA targeting human CCL19 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_006274 Rosetta Predictions human pricing
NM_001108661 Rosetta Predictions rat pricing
NM_011888 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_006274 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00070101 predicted 266
2 SASI_Hs01_00070102 predicted 295
3 SASI_Hs01_00070103 predicted 249
4 SASI_Hs01_00070104 predicted 305
5 SASI_Hs01_00070105 predicted 251
6 SASI_Hs01_00070106 predicted 204
7 SASI_Hs01_00070107 predicted 300
8 SASI_Hs01_00070108 predicted 307
9 SASI_Hs01_00070110 predicted 227
10 SASI_Hs02_00341238 predicted 261
11 SASI_Hs01_00070109 predicted 219
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001108661 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00240825 predicted 434
2 SASI_Rn02_00240826 predicted 215
3 SASI_Rn02_00240827 predicted 442
4 SASI_Rn02_00240828 predicted 430
5 SASI_Rn02_00240829 predicted 316
6 SASI_Rn02_00240830 predicted 269
7 SASI_Rn02_00240831 predicted 470
8 SASI_Rn02_00240832 predicted 311
9 SASI_Rn02_00240833 predicted 453
10 SASI_Rn02_00240834 predicted 364
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_011888 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00158026 predicted 212
2 SASI_Mm02_00321690 predicted 453
3 SASI_Mm01_00158028 predicted 333
4 SASI_Mm01_00158029 predicted 363
5 SASI_Mm01_00158030 predicted 324
6 SASI_Mm01_00158031 predicted 314
7 SASI_Mm01_00158032 predicted 373
8 SASI_Mm02_00321691 predicted 259
9 SASI_Mm01_00158034 predicted 337
10 SASI_Mm01_00158035 predicted 312
11 SASI_Mm01_00158027 predicted 442
12 SASI_Mm01_00158033 predicted 269
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_006274
CCL19 MISSION shRNA Bacterial Glycerol Stock
chemokine (C-C motif) ligand 19
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000058013    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006274.2-277s1c1
Sequence:CCGGCACTACCTTCTCATCAAGGATCTCGAGATCCTTGATGAGAAGGTAGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000058014    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006274.2-252s1c1
Sequence:CCGGCCCTGGGTACATCGTGAGGAACTCGAGTTCCTCACGATGTACCCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000058015    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006274.2-366s1c1
Sequence:CCGGGCCCTGGGTAGAACGCATCATCTCGAGATGATGCGTTCTACCCAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000058017    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006274.2-190s1c1
Sequence:CCGGCCAACTCTGAGTGGCACCAATCTCGAGATTGGTGCCACTCAGAGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000058016    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006274.2-206s1c1
Sequence:CCGGCCAATGATGCTGAAGACTGCTCTCGAGAGCAGTCTTCAGCATCATTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000371665    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006274.2-399s21c1
Sequence:CCGGGAGGACCTCAGCCAAGATGAACTCGAGTTCATCTTGGCTGAGGTCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000371605    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006274.2-467s21c1
Sequence:CCGGGAGTCAAGCATTGTGAATTATCTCGAGATAATTCACAATGCTTGACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000371604    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006274.2-308s21c1
Sequence:CCGGTGCCTGCTGTAGTGTTCACCACTCGAGTGGTGAACACTACAGCAGGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000371668    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006274.2-422s21c1
Sequence:CCGGGCCGCAGCAGTTAACCTATGACTCGAGTCATAGGTTAACTGCTGCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_006274
CCL19 MISSION shRNA shRNA Plasmid DNA
chemokine (C-C motif) ligand 19
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000058013    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006274.2-277s1c1
Sequence:CCGGCACTACCTTCTCATCAAGGATCTCGAGATCCTTGATGAGAAGGTAGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000058014    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006274.2-252s1c1
Sequence:CCGGCCCTGGGTACATCGTGAGGAACTCGAGTTCCTCACGATGTACCCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000058015    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006274.2-366s1c1
Sequence:CCGGGCCCTGGGTAGAACGCATCATCTCGAGATGATGCGTTCTACCCAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000058017    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006274.2-190s1c1
Sequence:CCGGCCAACTCTGAGTGGCACCAATCTCGAGATTGGTGCCACTCAGAGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000058016    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006274.2-206s1c1
Sequence:CCGGCCAATGATGCTGAAGACTGCTCTCGAGAGCAGTCTTCAGCATCATTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000371665    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006274.2-399s21c1
Sequence:CCGGGAGGACCTCAGCCAAGATGAACTCGAGTTCATCTTGGCTGAGGTCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000371605    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006274.2-467s21c1
Sequence:CCGGGAGTCAAGCATTGTGAATTATCTCGAGATAATTCACAATGCTTGACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000371604    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006274.2-308s21c1
Sequence:CCGGTGCCTGCTGTAGTGTTCACCACTCGAGTGGTGAACACTACAGCAGGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000371668    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006274.2-422s21c1
Sequence:CCGGGCCGCAGCAGTTAACCTATGACTCGAGTCATAGGTTAACTGCTGCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_006274
CCL19 MISSION shRNA Lentiviral Transduction Particles
chemokine (C-C motif) ligand 19
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000058013    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006274.2-277s1c1
Sequence:CCGGCACTACCTTCTCATCAAGGATCTCGAGATCCTTGATGAGAAGGTAGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000058014    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006274.2-252s1c1
Sequence:CCGGCCCTGGGTACATCGTGAGGAACTCGAGTTCCTCACGATGTACCCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000058015    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006274.2-366s1c1
Sequence:CCGGGCCCTGGGTAGAACGCATCATCTCGAGATGATGCGTTCTACCCAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000058017    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006274.2-190s1c1
Sequence:CCGGCCAACTCTGAGTGGCACCAATCTCGAGATTGGTGCCACTCAGAGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000058016    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006274.2-206s1c1
Sequence:CCGGCCAATGATGCTGAAGACTGCTCTCGAGAGCAGTCTTCAGCATCATTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000371665    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006274.2-399s21c1
Sequence:CCGGGAGGACCTCAGCCAAGATGAACTCGAGTTCATCTTGGCTGAGGTCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000371605    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006274.2-467s21c1
Sequence:CCGGGAGTCAAGCATTGTGAATTATCTCGAGATAATTCACAATGCTTGACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000371604    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006274.2-308s21c1
Sequence:CCGGTGCCTGCTGTAGTGTTCACCACTCGAGTGGTGAACACTACAGCAGGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000371668    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006274.2-422s21c1
Sequence:CCGGGCCGCAGCAGTTAACCTATGACTCGAGTCATAGGTTAACTGCTGCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_011888
CCL19 MISSION shRNA Bacterial Glycerol Stock
chemokine (C-C motif) ligand 19
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000067608    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011888.2-376s1c1
Sequence:CCGGCTGTTGTGTTCACCACACTAACTCGAGTTAGTGTGGTGAACACAACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000067610    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011888.2-339s1c1
Sequence:CCGGCGCTACCTTCTTAATGAAGATCTCGAGATCTTCATTAAGAAGGTAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000067611    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011888.2-478s1c1
Sequence:CCGGACAAAGGCAACAGCACCAGAACTCGAGTTCTGGTGCTGTTGCCTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000067612    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011888.2-333s1c1
Sequence:CCGGGCCTTCCGCTACCTTCTTAATCTCGAGATTAAGAAGGTAGCGGAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000067609    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011888.2-461s1c1
Sequence:CCGGGAAGTCTTCTGCCAAGAACAACTCGAGTTGTTCTTGGCAGAAGACTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_011888
CCL19 MISSION shRNA shRNA Plasmid DNA
chemokine (C-C motif) ligand 19
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000067608    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011888.2-376s1c1
Sequence:CCGGCTGTTGTGTTCACCACACTAACTCGAGTTAGTGTGGTGAACACAACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000067610    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011888.2-339s1c1
Sequence:CCGGCGCTACCTTCTTAATGAAGATCTCGAGATCTTCATTAAGAAGGTAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000067611    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011888.2-478s1c1
Sequence:CCGGACAAAGGCAACAGCACCAGAACTCGAGTTCTGGTGCTGTTGCCTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000067612    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011888.2-333s1c1
Sequence:CCGGGCCTTCCGCTACCTTCTTAATCTCGAGATTAAGAAGGTAGCGGAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000067609    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011888.2-461s1c1
Sequence:CCGGGAAGTCTTCTGCCAAGAACAACTCGAGTTGTTCTTGGCAGAAGACTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_011888
CCL19 MISSION shRNA Lentiviral Transduction Particles
chemokine (C-C motif) ligand 19
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000067608    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011888.2-376s1c1
Sequence:CCGGCTGTTGTGTTCACCACACTAACTCGAGTTAGTGTGGTGAACACAACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000067610    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011888.2-339s1c1
Sequence:CCGGCGCTACCTTCTTAATGAAGATCTCGAGATCTTCATTAAGAAGGTAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000067611    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011888.2-478s1c1
Sequence:CCGGACAAAGGCAACAGCACCAGAACTCGAGTTCTGGTGCTGTTGCCTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000067612    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011888.2-333s1c1
Sequence:CCGGGCCTTCCGCTACCTTCTTAATCTCGAGATTAAGAAGGTAGCGGAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000067609    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011888.2-461s1c1
Sequence:CCGGGAAGTCTTCTGCCAAGAACAACTCGAGTTGTTCTTGGCAGAAGACTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks