EMAIL THIS PAGE TO A FRIEND

CCL1

chemokine (C-C motif) ligand 1

74 Gene Product Result for
Synonyms: I-309 P500 SCYA1 SISe TCA3
UniProtKB ID: P22362, B2R5G9, Q2M309
Gene ID:
Human(6346) Summary: This gene is one of several chemokine genes clustered on the q-arm of chromosome 17. Chemokines form a superfamily of secreted proteins involved in immunoregulatory and inflammatory processes. The superfamily is divided into four subfamilies based on the arrangement of two N-terminal cysteine residues of the mature peptide. This chemokine, a member of the CC subfamily, is secreted by activated T cells and displays chemotactic activity for monocytes but not for neutrophils. It binds to the chemokine (C-C motif) receptor 8. [provided by RefSeq, Jul 2013]
Mouse(20290) chemokine (C-C motif) ligand 1
Rat(688605) chemokine (C-C motif) ligand 1
Zebrafish(30268) CC chemokine 1
chicken(395552) chemokine (C-C motif) ligand 1
domestic cat(101100011) chemokine (C-C motif) ligand 1
dog(448788) chemokine (C-C motif) ligand 1
cow(786156) chemokine (C-C motif) ligand 1
sheep(101114628) chemokine (C-C motif) ligand 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_002981 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_002981 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_002981 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_011329 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_011329 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_011329 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_002981 Rosetta Predictions human pricing
XM_001067590 Rosetta Predictions rat pricing
NM_011329 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_002981 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00334858 predicted 231
2 SASI_Hs01_00105842 predicted 277
3 SASI_Hs01_00105844 predicted 294
4 SASI_Hs01_00105845 predicted 242
5 SASI_Hs02_00334859 predicted 282
6 SASI_Hs01_00105846 predicted 286
7 SASI_Hs01_00105847 predicted 244
8 SASI_Hs01_00105848 predicted 202
9 SASI_Hs01_00105849 predicted 243
10 SASI_Hs01_00105850 predicted 201
11 SASI_Hs01_00105843 predicted 289
12 SASI_Hs01_00105851 predicted 210
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001067590 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00321494 predicted 184
2 SASI_Rn02_00321495 predicted 212
3 SASI_Rn02_00321496 predicted 165
4 SASI_Rn02_00321497 predicted 72
5 SASI_Rn02_00321498 predicted 165
6 SASI_Rn02_00321499 predicted 67
7 SASI_Rn02_00321500 predicted 210
8 SASI_Rn02_00321501 predicted 114
9 SASI_Rn02_00321502 predicted 204
10 SASI_Rn02_00321503 predicted 88
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_011329 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00028622 predicted 278
2 SASI_Mm01_00028623 predicted 277
3 SASI_Mm01_00028624 predicted 284
4 SASI_Mm01_00028625 predicted 278
5 SASI_Mm01_00028626 predicted 247
6 SASI_Mm01_00028627 predicted 245
7 SASI_Mm01_00028628 predicted 283
8 SASI_Mm01_00028629 predicted 245
9 SASI_Mm01_00028630 predicted 276
10 SASI_Mm01_00028631 predicted 193
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_002981
CCL1 MISSION shRNA Bacterial Glycerol Stock
chemokine (C-C motif) ligand 1
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000057853    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002981.1-172s1c1
Sequence:CCGGTGCTTCTCATTTGCGGAGCAACTCGAGTTGCTCCGCAAATGAGAAGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000057856    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002981.1-333s1c1
Sequence:CCGGGCTGAGGCACTGCCCGTCAAACTCGAGTTTGACGGGCAGTGCCTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000057857    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002981.1-201s1c1
Sequence:CCGGCCTGAGGGCAATCCTGTGTTACTCGAGTAACACAGGATTGCCCTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000057855    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002981.1-240s1c1
Sequence:CCGGCTGCTCCAATGAGGGCTTAATCTCGAGATTAAGCCCTCATTGGAGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000057854    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002981.1-208s1c1
Sequence:CCGGGCAATCCTGTGTTACAGAAATCTCGAGATTTCTGTAACACAGGATTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000371650    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002981.1-362s21c1
Sequence:CCGGGAGCAGATTTCTTTCCATTGTCTCGAGACAATGGAAAGAAATCTGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000371651    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002981.1-125s21c1
Sequence:CCGGCGGAAGATGTGGACAGCAAGACTCGAGTCTTGCTGTCCACATCTTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_002981
CCL1 MISSION shRNA shRNA Plasmid DNA
chemokine (C-C motif) ligand 1
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000057853    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002981.1-172s1c1
Sequence:CCGGTGCTTCTCATTTGCGGAGCAACTCGAGTTGCTCCGCAAATGAGAAGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000057856    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002981.1-333s1c1
Sequence:CCGGGCTGAGGCACTGCCCGTCAAACTCGAGTTTGACGGGCAGTGCCTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000057857    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002981.1-201s1c1
Sequence:CCGGCCTGAGGGCAATCCTGTGTTACTCGAGTAACACAGGATTGCCCTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000057855    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002981.1-240s1c1
Sequence:CCGGCTGCTCCAATGAGGGCTTAATCTCGAGATTAAGCCCTCATTGGAGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000057854    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002981.1-208s1c1
Sequence:CCGGGCAATCCTGTGTTACAGAAATCTCGAGATTTCTGTAACACAGGATTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000371650    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002981.1-362s21c1
Sequence:CCGGGAGCAGATTTCTTTCCATTGTCTCGAGACAATGGAAAGAAATCTGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000371651    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002981.1-125s21c1
Sequence:CCGGCGGAAGATGTGGACAGCAAGACTCGAGTCTTGCTGTCCACATCTTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_002981
CCL1 MISSION shRNA Lentiviral Transduction Particles
chemokine (C-C motif) ligand 1
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000057853    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002981.1-172s1c1
Sequence:CCGGTGCTTCTCATTTGCGGAGCAACTCGAGTTGCTCCGCAAATGAGAAGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000057856    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002981.1-333s1c1
Sequence:CCGGGCTGAGGCACTGCCCGTCAAACTCGAGTTTGACGGGCAGTGCCTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000057857    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002981.1-201s1c1
Sequence:CCGGCCTGAGGGCAATCCTGTGTTACTCGAGTAACACAGGATTGCCCTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000057855    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002981.1-240s1c1
Sequence:CCGGCTGCTCCAATGAGGGCTTAATCTCGAGATTAAGCCCTCATTGGAGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000057854    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002981.1-208s1c1
Sequence:CCGGGCAATCCTGTGTTACAGAAATCTCGAGATTTCTGTAACACAGGATTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000371650    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002981.1-362s21c1
Sequence:CCGGGAGCAGATTTCTTTCCATTGTCTCGAGACAATGGAAAGAAATCTGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000371651    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002981.1-125s21c1
Sequence:CCGGCGGAAGATGTGGACAGCAAGACTCGAGTCTTGCTGTCCACATCTTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_011329
CCL1 MISSION shRNA Bacterial Glycerol Stock
chemokine (C-C motif) ligand 1
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000077013    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011329.1-206s1c1
Sequence:CCGGGTTTATCCAGTGTTACAGAAACTCGAGTTTCTGTAACACTGGATAAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000077017    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011329.1-167s1c1
Sequence:CCGGCTGCTGCTTGAACACCTTGAACTCGAGTTCAAGGTGTTCAAGCAGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000077016    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011329.1-114s1c1
Sequence:CCGGGCCGTGTGGATACAGGATGTTCTCGAGAACATCCTGTATCCACACGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000222635    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011329.1-254s1c2
Sequence:CCGGAGCTGTGGTATTCAGGCTGAACTCGAGTTCAGCCTGAATACCACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000222634    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011329.1-145s1c2
Sequence:CCGGGCATGCTTACGGTCTCCAATACTCGAGTATTGGAGACCGTAAGCATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_011329
CCL1 MISSION shRNA shRNA Plasmid DNA
chemokine (C-C motif) ligand 1
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000077013    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011329.1-206s1c1
Sequence:CCGGGTTTATCCAGTGTTACAGAAACTCGAGTTTCTGTAACACTGGATAAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000077017    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011329.1-167s1c1
Sequence:CCGGCTGCTGCTTGAACACCTTGAACTCGAGTTCAAGGTGTTCAAGCAGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000077016    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011329.1-114s1c1
Sequence:CCGGGCCGTGTGGATACAGGATGTTCTCGAGAACATCCTGTATCCACACGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000222635    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011329.1-254s1c2
Sequence:CCGGAGCTGTGGTATTCAGGCTGAACTCGAGTTCAGCCTGAATACCACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000222634    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011329.1-145s1c2
Sequence:CCGGGCATGCTTACGGTCTCCAATACTCGAGTATTGGAGACCGTAAGCATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_011329
CCL1 MISSION shRNA Lentiviral Transduction Particles
chemokine (C-C motif) ligand 1
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000077013    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011329.1-206s1c1
Sequence:CCGGGTTTATCCAGTGTTACAGAAACTCGAGTTTCTGTAACACTGGATAAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000077017    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011329.1-167s1c1
Sequence:CCGGCTGCTGCTTGAACACCTTGAACTCGAGTTCAAGGTGTTCAAGCAGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000077016    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011329.1-114s1c1
Sequence:CCGGGCCGTGTGGATACAGGATGTTCTCGAGAACATCCTGTATCCACACGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000222635    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011329.1-254s1c2
Sequence:CCGGAGCTGTGGTATTCAGGCTGAACTCGAGTTCAGCCTGAATACCACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000222634    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011329.1-145s1c2
Sequence:CCGGGCATGCTTACGGTCTCCAATACTCGAGTATTGGAGACCGTAAGCATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks