EMAIL THIS PAGE TO A FRIEND

CCL20

chemokine (C-C motif) ligand 20

84 Gene Product Result for
Synonyms: CKb4 LARC MIP-3-alpha MIP-3a MIP3A SCYA20 ST38
UniProtKB ID: P78556, Q53S51, Q99664
Gene ID:
Mouse(20297) chemokine (C-C motif) ligand 20
Rat(29538) chemokine (C-C motif) ligand 20
Zebrafish(563152) chemokine (C-C motif) ligand 20
cow(281666) chemokine (C-C motif) ligand 20
domestic cat(101089032) chemokine (C-C motif) ligand 20
dog(448790) chemokine (C-C motif) ligand 20
chicken(395082) chemokine (C-C motif) ligand 20
sheep(101104302) chemokine (C-C motif) ligand 20
domestic guinea pig(100714505) chemokine (C-C motif) ligand 20
naked mole-rat(101716599) chemokine (C-C motif) ligand 20
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_004591 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_004591 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_004591 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_016960 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_016960 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_016960 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU095461 MISSION® esiRNA esiRNA human CCL20 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_004591 Rosetta Predictions human pricing
NM_019233 Rosetta Predictions rat pricing
NM_016960 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004591 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00124576 predicted 268
2 SASI_Hs01_00124577 predicted 372
3 SASI_Hs01_00124578 predicted 435
4 SASI_Hs01_00124579 predicted 435
5 SASI_Hs01_00124580 predicted 525
6 SASI_Hs02_00337954 predicted 285
7 SASI_Hs01_00124581 predicted 216
8 SASI_Hs01_00124582 predicted 475
9 SASI_Hs01_00124583 predicted 483
10 SASI_Hs01_00124584 predicted 508
11 SASI_Hs01_00124585 predicted 478
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_019233 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00077931 predicted 215
2 SASI_Rn01_00077932 predicted 488
3 SASI_Rn01_00077933 predicted 503
4 SASI_Rn02_00262100 predicted 460
5 SASI_Rn01_00077934 predicted 533
6 SASI_Rn01_00077935 predicted 274
7 SASI_Rn01_00077936 predicted 517
8 SASI_Rn01_00077937 predicted 221
9 SASI_Rn01_00077938 predicted 211
10 SASI_Rn01_00077939 predicted 466
11 SASI_Rn01_00077930 predicted 497
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_016960 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00135683 predicted 503
2 SASI_Mm01_00135684 predicted 209
3 SASI_Mm01_00135685 predicted 478
4 SASI_Mm01_00135686 predicted 203
5 SASI_Mm01_00135687 predicted 259
6 SASI_Mm01_00135689 predicted 495
7 SASI_Mm01_00135690 predicted 461
8 SASI_Mm02_00323810 predicted 529
9 SASI_Mm01_00135691 predicted 552
10 SASI_Mm01_00135692 predicted 214
11 SASI_Mm01_00135688 predicted 480
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_004591
CCL20 MISSION shRNA Bacterial Glycerol Stock
chemokine (C-C motif) ligand 20
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000057963    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004591.1-170s1c1
Sequence:CCGGGACCGTATTCTTCATCCTAAACTCGAGTTTAGGATGAAGAATACGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000057964    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004591.1-124s1c1
Sequence:CCGGCGAATCAGAAGCAGCAAGCAACTCGAGTTGCTTGCTGCTTCTGATTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000057967    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004591.1-311s1c1
Sequence:CCGGATTGTGCGTCTCCTCAGTAAACTCGAGTTTACTGAGGAGACGCACAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000057966    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004591.1-241s1c1
Sequence:CCGGTGCTATCATCTTTCACACAAACTCGAGTTTGTGTGAAAGATGATAGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000057965    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004591.1-157s1c1
Sequence:CCGGTCTTGGATACACAGACCGTATCTCGAGATACGGTCTGTGTATCCAAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000371669    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004591.2-279s21c1
Sequence:CCGGAGTTGTCTGTGTGCGCAAATCCTCGAGGATTTGCGCACACAGACAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000371608    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004591.2-451s21c1
Sequence:CCGGAGGGTTTAGTGCTTATCTAATCTCGAGATTAGATAAGCACTAAACCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000371670    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004591.2-505s21c1
Sequence:CCGGTTGATTCATATTGCATCATAGCTCGAGCTATGATGCAATATGAATCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_004591
CCL20 MISSION shRNA shRNA Plasmid DNA
chemokine (C-C motif) ligand 20
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000057963    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004591.1-170s1c1
Sequence:CCGGGACCGTATTCTTCATCCTAAACTCGAGTTTAGGATGAAGAATACGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000057964    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004591.1-124s1c1
Sequence:CCGGCGAATCAGAAGCAGCAAGCAACTCGAGTTGCTTGCTGCTTCTGATTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000057967    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004591.1-311s1c1
Sequence:CCGGATTGTGCGTCTCCTCAGTAAACTCGAGTTTACTGAGGAGACGCACAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000057966    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004591.1-241s1c1
Sequence:CCGGTGCTATCATCTTTCACACAAACTCGAGTTTGTGTGAAAGATGATAGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000057965    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004591.1-157s1c1
Sequence:CCGGTCTTGGATACACAGACCGTATCTCGAGATACGGTCTGTGTATCCAAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000371669    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004591.2-279s21c1
Sequence:CCGGAGTTGTCTGTGTGCGCAAATCCTCGAGGATTTGCGCACACAGACAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000371608    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004591.2-451s21c1
Sequence:CCGGAGGGTTTAGTGCTTATCTAATCTCGAGATTAGATAAGCACTAAACCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000371670    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004591.2-505s21c1
Sequence:CCGGTTGATTCATATTGCATCATAGCTCGAGCTATGATGCAATATGAATCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_004591
CCL20 MISSION shRNA Lentiviral Transduction Particles
chemokine (C-C motif) ligand 20
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000057963    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004591.1-170s1c1
Sequence:CCGGGACCGTATTCTTCATCCTAAACTCGAGTTTAGGATGAAGAATACGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000057964    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004591.1-124s1c1
Sequence:CCGGCGAATCAGAAGCAGCAAGCAACTCGAGTTGCTTGCTGCTTCTGATTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000057967    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004591.1-311s1c1
Sequence:CCGGATTGTGCGTCTCCTCAGTAAACTCGAGTTTACTGAGGAGACGCACAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000057966    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004591.1-241s1c1
Sequence:CCGGTGCTATCATCTTTCACACAAACTCGAGTTTGTGTGAAAGATGATAGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000057965    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004591.1-157s1c1
Sequence:CCGGTCTTGGATACACAGACCGTATCTCGAGATACGGTCTGTGTATCCAAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000371669    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004591.2-279s21c1
Sequence:CCGGAGTTGTCTGTGTGCGCAAATCCTCGAGGATTTGCGCACACAGACAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000371608    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004591.2-451s21c1
Sequence:CCGGAGGGTTTAGTGCTTATCTAATCTCGAGATTAGATAAGCACTAAACCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000371670    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004591.2-505s21c1
Sequence:CCGGTTGATTCATATTGCATCATAGCTCGAGCTATGATGCAATATGAATCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_016960
VALIDATED
CCL20 MISSION shRNA Bacterial Glycerol Stock
chemokine (C-C motif) ligand 20
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000067703    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_016960.1-446s1c1
Sequence:CCGGCCAGTGGACTTGTCAATGGATCTCGAGATCCATTGACAAGTCCACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000067704    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016960.1-315s1c1
Sequence:CCGGCCTAAGAGTCAAGAAGATGTACTCGAGTACATCTTCTTGACTCTTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000067706    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016960.1-274s1c1
Sequence:CCGGCCAAAGCAGAACTGGGTGAAACTCGAGTTTCACCCAGTTCTGCTTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000067707    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016960.1-148s1c1
Sequence:CCGGTCGTACATACAGACGCCTCTTCTCGAGAAGAGGCGTCTGTATGTACGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000067705    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016960.1-206s1c1
Sequence:CCGGCCGATGAAGCTTGTGACATTACTCGAGTAATGTCACAAGCTTCATCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000305873    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016960.2-617s21c1
Sequence:CCGGGCGCTTAGTGGAAGGATTAATCTCGAGATTAATCCTTCCACTAAGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000305871    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016960.2-247s21c1
Sequence:CCGGTATCATCTTTCACACGAAGAACTCGAGTTCTTCGTGTGAAAGATGATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000324944    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_016960.2-290s21c1
Sequence:CCGGCCAAAGCAGAACTGGGTGAAACTCGAGTTTCACCCAGTTCTGCTTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000353952    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_016960.2-331s21c1
Sequence:CCGGCCTAAGAGTCAAGAAGATGTACTCGAGTACATCTTCTTGACTCTTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_016960
VALIDATED
CCL20 MISSION shRNA shRNA Plasmid DNA
chemokine (C-C motif) ligand 20
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000067703    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_016960.1-446s1c1
Sequence:CCGGCCAGTGGACTTGTCAATGGATCTCGAGATCCATTGACAAGTCCACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000067704    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016960.1-315s1c1
Sequence:CCGGCCTAAGAGTCAAGAAGATGTACTCGAGTACATCTTCTTGACTCTTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000067706    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016960.1-274s1c1
Sequence:CCGGCCAAAGCAGAACTGGGTGAAACTCGAGTTTCACCCAGTTCTGCTTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000067707    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016960.1-148s1c1
Sequence:CCGGTCGTACATACAGACGCCTCTTCTCGAGAAGAGGCGTCTGTATGTACGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000067705    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016960.1-206s1c1
Sequence:CCGGCCGATGAAGCTTGTGACATTACTCGAGTAATGTCACAAGCTTCATCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000305873    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016960.2-617s21c1
Sequence:CCGGGCGCTTAGTGGAAGGATTAATCTCGAGATTAATCCTTCCACTAAGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000305871    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016960.2-247s21c1
Sequence:CCGGTATCATCTTTCACACGAAGAACTCGAGTTCTTCGTGTGAAAGATGATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000324944    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_016960.2-290s21c1
Sequence:CCGGCCAAAGCAGAACTGGGTGAAACTCGAGTTTCACCCAGTTCTGCTTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000353952    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_016960.2-331s21c1
Sequence:CCGGCCTAAGAGTCAAGAAGATGTACTCGAGTACATCTTCTTGACTCTTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_016960
VALIDATED
CCL20 MISSION shRNA Lentiviral Transduction Particles
chemokine (C-C motif) ligand 20
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000067703    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_016960.1-446s1c1
Sequence:CCGGCCAGTGGACTTGTCAATGGATCTCGAGATCCATTGACAAGTCCACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000067704    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016960.1-315s1c1
Sequence:CCGGCCTAAGAGTCAAGAAGATGTACTCGAGTACATCTTCTTGACTCTTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000067706    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016960.1-274s1c1
Sequence:CCGGCCAAAGCAGAACTGGGTGAAACTCGAGTTTCACCCAGTTCTGCTTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000067707    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016960.1-148s1c1
Sequence:CCGGTCGTACATACAGACGCCTCTTCTCGAGAAGAGGCGTCTGTATGTACGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000067705    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016960.1-206s1c1
Sequence:CCGGCCGATGAAGCTTGTGACATTACTCGAGTAATGTCACAAGCTTCATCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000305873    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016960.2-617s21c1
Sequence:CCGGGCGCTTAGTGGAAGGATTAATCTCGAGATTAATCCTTCCACTAAGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000305871    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016960.2-247s21c1
Sequence:CCGGTATCATCTTTCACACGAAGAACTCGAGTTCTTCGTGTGAAAGATGATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000324944    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_016960.2-290s21c1
Sequence:CCGGCCAAAGCAGAACTGGGTGAAACTCGAGTTTCACCCAGTTCTGCTTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000353952    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_016960.2-331s21c1
Sequence:CCGGCCTAAGAGTCAAGAAGATGTACTCGAGTACATCTTCTTGACTCTTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks