EMAIL THIS PAGE TO A FRIEND

CCL21

chemokine (C-C motif) ligand 21

73 Gene Product Result for
Synonyms: 6Ckine CKb9 ECL SCYA21 SLC TCA4
UniProtKB ID: O00585
Gene ID:
Human(6366) Summary: This gene is one of several CC cytokine genes clustered on the p-arm of chromosome 9. Cytokines are a family of secreted proteins involved in immunoregulatory and inflammatory processes. The CC cytokines are proteins characterized by two adjacent cysteines. Similar to other chemokines the protein encoded by this gene inhibits hemopoiesis and stimulates chemotaxis. This protein is chemotactic in vitro for thymocytes and activated T cells, but not for B cells, macrophages, or neutrophils. The cytokine encoded by this gene may also play a role in mediating homing of lymphocytes to secondary lymphoid organs. It is a high affinity functional ligand for chemokine receptor 7 that is expressed on T and B lymphocytes and a known receptor for another member of the cytokine family (small inducible cytokine A19). [provided by RefSeq, May 2013]
Rat(298006) chemokine (C-C motif) ligand 21
sheep(101119957) chemokine (C-C motif) ligand 21
domestic cat(101087275) chemokine (C-C motif) ligand 21
cow(511112) chemokine (C-C motif) ligand 21
dog(448796) chemokine (C-C motif) ligand 21
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_002989 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_002989 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_002989 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU012861 MISSION® esiRNA esiRNA targeting human CCL21 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_002989 Rosetta Predictions human pricing
NM_001008513 Rosetta Predictions rat pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_002989 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00127115 predicted 532
2 SASI_Hs01_00127116 predicted 536
3 SASI_Hs01_00127117 predicted 410
4 SASI_Hs02_00334865 predicted 435
5 SASI_Hs01_00127118 predicted 206
6 SASI_Hs01_00127119 predicted 400
7 SASI_Hs01_00127121 predicted 207
8 SASI_Hs01_00127122 predicted 420
9 SASI_Hs01_00127123 predicted 223
10 SASI_Hs01_00127124 predicted 427
11 SASI_Hs01_00127120 predicted 543
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001008513 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00036336 predicted 350
2 SASI_Rn02_00199193 predicted 554
3 SASI_Rn01_00036337 predicted 248
4 SASI_Rn01_00036338 predicted 568
5 SASI_Rn02_00199194 predicted 487
6 SASI_Rn01_00036339 predicted 356
7 SASI_Rn01_00036340 predicted 518
8 SASI_Rn01_00036341 predicted 357
9 SASI_Rn01_00036342 predicted 421
10 SASI_Rn01_00036343 predicted 458
11 SASI_Rn01_00036344 predicted 589
12 SASI_Rn01_00036345 predicted 433
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_002989
CCL21 MISSION shRNA Bacterial Glycerol Stock
chemokine (C-C motif) ligand 21
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000377743    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002989.2-617s21c1
Sequence:CCGGCACTCTTTCTCCTGCTTTAACCTCGAGGTTAAAGCAGGAGAAAGAGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000371609    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002989.2-301s21c1
Sequence:CCGGGAGCTATGTGCAGACCCAAAGCTCGAGCTTTGGGTCTGCACATAGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000377744    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002989.2-257s21c1
Sequence:CCGGCCATCCCAGCTATCCTGTTCTCTCGAGAGAACAGGATAGCTGGGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000057918    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002989.2-180s1c1
Sequence:CCGGCCTCAAGTACAGCCAAAGGAACTCGAGTTCCTTTGGCTGTACTTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000057920    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002989.2-168s1c1
Sequence:CCGGTCAGGACTGTTGCCTCAAGTACTCGAGTACTTGAGGCAACAGTCCTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000057922    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002989.2-229s1c1
Sequence:CCGGCGGAAGCAGGAACCAAGCTTACTCGAGTAAGCTTGGTTCCTGCTTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000057921    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002989.2-112s1c1
Sequence:CCGGCTTATCCTGGTTCTGGCCTTTCTCGAGAAAGGCCAGAACCAGGATAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000057919    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002989.2-423s1c1
Sequence:CCGGCAAGAAAGGAAAGGGCTCCAACTCGAGTTGGAGCCCTTTCCTTTCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_002989
CCL21 MISSION shRNA shRNA Plasmid DNA
chemokine (C-C motif) ligand 21
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000377743    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002989.2-617s21c1
Sequence:CCGGCACTCTTTCTCCTGCTTTAACCTCGAGGTTAAAGCAGGAGAAAGAGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000371609    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002989.2-301s21c1
Sequence:CCGGGAGCTATGTGCAGACCCAAAGCTCGAGCTTTGGGTCTGCACATAGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000377744    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002989.2-257s21c1
Sequence:CCGGCCATCCCAGCTATCCTGTTCTCTCGAGAGAACAGGATAGCTGGGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000057918    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002989.2-180s1c1
Sequence:CCGGCCTCAAGTACAGCCAAAGGAACTCGAGTTCCTTTGGCTGTACTTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000057920    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002989.2-168s1c1
Sequence:CCGGTCAGGACTGTTGCCTCAAGTACTCGAGTACTTGAGGCAACAGTCCTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000057922    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002989.2-229s1c1
Sequence:CCGGCGGAAGCAGGAACCAAGCTTACTCGAGTAAGCTTGGTTCCTGCTTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000057921    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002989.2-112s1c1
Sequence:CCGGCTTATCCTGGTTCTGGCCTTTCTCGAGAAAGGCCAGAACCAGGATAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000057919    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002989.2-423s1c1
Sequence:CCGGCAAGAAAGGAAAGGGCTCCAACTCGAGTTGGAGCCCTTTCCTTTCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_002989
CCL21 MISSION shRNA Lentiviral Transduction Particles
chemokine (C-C motif) ligand 21
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000377743    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002989.2-617s21c1
Sequence:CCGGCACTCTTTCTCCTGCTTTAACCTCGAGGTTAAAGCAGGAGAAAGAGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000371609    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002989.2-301s21c1
Sequence:CCGGGAGCTATGTGCAGACCCAAAGCTCGAGCTTTGGGTCTGCACATAGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000377744    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002989.2-257s21c1
Sequence:CCGGCCATCCCAGCTATCCTGTTCTCTCGAGAGAACAGGATAGCTGGGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000057918    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002989.2-180s1c1
Sequence:CCGGCCTCAAGTACAGCCAAAGGAACTCGAGTTCCTTTGGCTGTACTTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000057920    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002989.2-168s1c1
Sequence:CCGGTCAGGACTGTTGCCTCAAGTACTCGAGTACTTGAGGCAACAGTCCTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000057922    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002989.2-229s1c1
Sequence:CCGGCGGAAGCAGGAACCAAGCTTACTCGAGTAAGCTTGGTTCCTGCTTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000057921    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002989.2-112s1c1
Sequence:CCGGCTTATCCTGGTTCTGGCCTTTCTCGAGAAAGGCCAGAACCAGGATAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000057919    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002989.2-423s1c1
Sequence:CCGGCAAGAAAGGAAAGGGCTCCAACTCGAGTTGGAGCCCTTTCCTTTCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks