EMAIL THIS PAGE TO A FRIEND

CCL22

chemokine (C-C motif) ligand 22

174 Gene Product Result for
Synonyms: ABCD-1 DC/B-CK MDC SCYA22 STCP-1
UniProtKB ID: O00626, A0N0Q6, B2R4W2
Gene ID:
Human(6367) Summary: This gene is one of several Cys-Cys (CC) cytokine genes clustered on the q arm of chromosome 16. Cytokines are a family of secreted proteins involved in immunoregulatory and inflammatory processes. The CC cytokines are proteins characterized by two adjacent cysteines. The cytokine encoded by this gene displays chemotactic activity for monocytes, dendritic cells, natural killer cells and for chronically activated T lymphocytes. It also displays a mild activity for primary activated T lymphocytes and has no chemoattractant activity for neutrophils, eosinophils and resting T lymphocytes. The product of this gene binds to chemokine receptor CCR4. This chemokine may play a role in the trafficking of activated T lymphocytes to inflammatory sites and other aspects of activated T lymphocyte physiology. [provided by RefSeq, Jul 2008]
Mouse(20299) chemokine (C-C motif) ligand 22
Rat(117551) chemokine (C-C motif) ligand 22
naked mole-rat(101699782) chemokine (C-C motif) ligand 22
domestic guinea pig(100716085) chemokine (C-C motif) ligand 22
sheep(101123141) chemokine (C-C motif) ligand 22
cow(616996) chemokine (C-C motif) ligand 22
domestic cat(101091326) chemokine (C-C motif) ligand 22
dog(100686212) chemokine (C-C motif) ligand 22
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_009137 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_009137 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_009137 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_002990 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_002990 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_002990 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU137861 MISSION® esiRNA esiRNA human CCL22 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_002990 Rosetta Predictions human pricing
NM_057203 Rosetta Predictions rat pricing
NM_009137 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_002990 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00063283 predicted 345
2 SASI_Hs01_00063284 predicted 646
3 SASI_Hs01_00063285 predicted 388
4 SASI_Hs01_00063286 predicted 564
5 SASI_Hs01_00063287 predicted 508
6 SASI_Hs01_00063288 predicted 607
7 SASI_Hs01_00063289 predicted 286
8 SASI_Hs01_00063290 predicted 647
9 SASI_Hs01_00063291 predicted 208
10 SASI_Hs01_00063292 predicted 739
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_057203 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00099834 predicted 620
2 SASI_Rn01_00099835 predicted 262
3 SASI_Rn02_00267155 predicted 369
4 SASI_Rn01_00099836 predicted 502
5 SASI_Rn02_00267156 predicted 387
6 SASI_Rn01_00099838 predicted 630
7 SASI_Rn01_00099840 predicted 283
8 SASI_Rn01_00099841 predicted 797
9 SASI_Rn01_00099842 predicted 440
10 SASI_Rn01_00099843 predicted 292
11 SASI_Rn01_00099837 predicted 515
12 SASI_Rn01_00099839 predicted 724
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_009137 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00088638 predicted 693
2 SASI_Mm01_00088639 predicted 521
3 SASI_Mm01_00088641 predicted 270
4 SASI_Mm01_00088642 predicted 348
5 SASI_Mm01_00088643 predicted 650
6 SASI_Mm02_00315437 predicted 273
7 SASI_Mm02_00315438 predicted 652
8 SASI_Mm02_00315439 predicted 269
9 SASI_Mm01_00088644 predicted 235
10 SASI_Mm01_00088645 predicted 743
11 SASI_Mm01_00088637 predicted 258
12 SASI_Mm01_00088640 predicted 604
13 SASI_Mm01_00088646 predicted 767
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_009137
CCL22 MISSION shRNA Bacterial Glycerol Stock
chemokine (C-C motif) ligand 22
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000067833    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_009137.1-1041s1c1
Sequence:CCGGGCTCAGAATCAGATTTCTTAACTCGAGTTAAGAAATCTGATTCTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000067836    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009137.1-369s1c1
Sequence:CCGGTGGGTGAAGAAGCTACTCCATCTCGAGATGGAGTAGCTTCTTCACCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000067837    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009137.1-205s1c1
Sequence:CCGGGTGCCAATGTGGAAGACAGTACTCGAGTACTGTCTTCCACATTGGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000067835    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009137.1-257s1c1
Sequence:CCGGGCCATCACGTTTAGTGAAGGACTCGAGTCCTTCACTAAACGTGATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000067834    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009137.1-380s1c1
Sequence:CCGGGCTACTCCATAAACTGTCCTACTCGAGTAGGACAGTTTATGGAGTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_009137
CCL22 MISSION shRNA shRNA Plasmid DNA
chemokine (C-C motif) ligand 22
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000067833    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_009137.1-1041s1c1
Sequence:CCGGGCTCAGAATCAGATTTCTTAACTCGAGTTAAGAAATCTGATTCTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000067836    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009137.1-369s1c1
Sequence:CCGGTGGGTGAAGAAGCTACTCCATCTCGAGATGGAGTAGCTTCTTCACCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000067837    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009137.1-205s1c1
Sequence:CCGGGTGCCAATGTGGAAGACAGTACTCGAGTACTGTCTTCCACATTGGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000067835    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009137.1-257s1c1
Sequence:CCGGGCCATCACGTTTAGTGAAGGACTCGAGTCCTTCACTAAACGTGATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000067834    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009137.1-380s1c1
Sequence:CCGGGCTACTCCATAAACTGTCCTACTCGAGTAGGACAGTTTATGGAGTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_009137
CCL22 MISSION shRNA Lentiviral Transduction Particles
chemokine (C-C motif) ligand 22
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000067833    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_009137.1-1041s1c1
Sequence:CCGGGCTCAGAATCAGATTTCTTAACTCGAGTTAAGAAATCTGATTCTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000067836    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009137.1-369s1c1
Sequence:CCGGTGGGTGAAGAAGCTACTCCATCTCGAGATGGAGTAGCTTCTTCACCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000067837    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009137.1-205s1c1
Sequence:CCGGGTGCCAATGTGGAAGACAGTACTCGAGTACTGTCTTCCACATTGGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000067835    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009137.1-257s1c1
Sequence:CCGGGCCATCACGTTTAGTGAAGGACTCGAGTCCTTCACTAAACGTGATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000067834    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009137.1-380s1c1
Sequence:CCGGGCTACTCCATAAACTGTCCTACTCGAGTAGGACAGTTTATGGAGTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_002990
CCL22 MISSION shRNA Bacterial Glycerol Stock
chemokine (C-C motif) ligand 22
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000057998    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002990.3-258s1c1
Sequence:CCGGTGGGTGAAGATGATTCTCAATCTCGAGATTGAGAATCATCTTCACCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000057999    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002990.3-154s1c1
Sequence:CCGGGCGTGGTGAAACACTTCTACTCTCGAGAGTAGAAGTGTTTCACCACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000058000    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002990.3-118s1c1
Sequence:CCGGGCTGCCGTGATTACGTCCGTTCTCGAGAACGGACGTAATCACGGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000058002    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002990.3-269s1c1
Sequence:CCGGGATTCTCAATAAGCTGAGCCACTCGAGTGGCTCAGCTTATTGAGAATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000058001    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002990.3-212s1c1
Sequence:CCGGGCTAACCTTCAGGGATAAGGACTCGAGTCCTTATCCCTGAAGGTTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000377745    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002990.3-345s21c1
Sequence:CCGGCCCTACCTCCCTGCCATTATACTCGAGTATAATGGCAGGGAGGTAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000371674    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002990.3-291s21c1
Sequence:CCGGTGAAGAGCCTACTCTGATGACCTCGAGGTCATCAGAGTAGGCTCTTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000371675    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002990.3-730s21c1
Sequence:CCGGATGTTGCTGACACCCAGAAAGCTCGAGCTTTCTGGGTGTCAGCAACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_002990
CCL22 MISSION shRNA shRNA Plasmid DNA
chemokine (C-C motif) ligand 22
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000057998    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002990.3-258s1c1
Sequence:CCGGTGGGTGAAGATGATTCTCAATCTCGAGATTGAGAATCATCTTCACCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000057999    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002990.3-154s1c1
Sequence:CCGGGCGTGGTGAAACACTTCTACTCTCGAGAGTAGAAGTGTTTCACCACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000058000    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002990.3-118s1c1
Sequence:CCGGGCTGCCGTGATTACGTCCGTTCTCGAGAACGGACGTAATCACGGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000058002    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002990.3-269s1c1
Sequence:CCGGGATTCTCAATAAGCTGAGCCACTCGAGTGGCTCAGCTTATTGAGAATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000058001    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002990.3-212s1c1
Sequence:CCGGGCTAACCTTCAGGGATAAGGACTCGAGTCCTTATCCCTGAAGGTTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000377745    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002990.3-345s21c1
Sequence:CCGGCCCTACCTCCCTGCCATTATACTCGAGTATAATGGCAGGGAGGTAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000371674    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002990.3-291s21c1
Sequence:CCGGTGAAGAGCCTACTCTGATGACCTCGAGGTCATCAGAGTAGGCTCTTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000371675    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002990.3-730s21c1
Sequence:CCGGATGTTGCTGACACCCAGAAAGCTCGAGCTTTCTGGGTGTCAGCAACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_002990
CCL22 MISSION shRNA Lentiviral Transduction Particles
chemokine (C-C motif) ligand 22
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000057998    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002990.3-258s1c1
Sequence:CCGGTGGGTGAAGATGATTCTCAATCTCGAGATTGAGAATCATCTTCACCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000057999    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002990.3-154s1c1
Sequence:CCGGGCGTGGTGAAACACTTCTACTCTCGAGAGTAGAAGTGTTTCACCACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000058000    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002990.3-118s1c1
Sequence:CCGGGCTGCCGTGATTACGTCCGTTCTCGAGAACGGACGTAATCACGGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000058002    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002990.3-269s1c1
Sequence:CCGGGATTCTCAATAAGCTGAGCCACTCGAGTGGCTCAGCTTATTGAGAATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000058001    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002990.3-212s1c1
Sequence:CCGGGCTAACCTTCAGGGATAAGGACTCGAGTCCTTATCCCTGAAGGTTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000377745    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002990.3-345s21c1
Sequence:CCGGCCCTACCTCCCTGCCATTATACTCGAGTATAATGGCAGGGAGGTAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000371674    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002990.3-291s21c1
Sequence:CCGGTGAAGAGCCTACTCTGATGACCTCGAGGTCATCAGAGTAGGCTCTTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000371675    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002990.3-730s21c1
Sequence:CCGGATGTTGCTGACACCCAGAAAGCTCGAGCTTTCTGGGTGTCAGCAACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks