EMAIL THIS PAGE TO A FRIEND

CCL23

chemokine (C-C motif) ligand 23

35 Gene Product Result for
Synonyms: CK-BETA-8 CKb8 Ckb-8 Ckb-8-1 MIP-3 MIP3 MPIF-1 SCYA23 hmrp-2a
UniProtKB ID: P55773, B7ZKQ3, O00174, O75950, Q52LD4
Gene ID:
Human(6368) Summary: This gene is one of several chemokine genes clustered on the q-arm of chromosome 17. Chemokines form a superfamily of secreted proteins involved in immunoregulatory and inflammatory processes. The superfamily is divided into four subfamilies based on the arrangement of the N-terminal two cysteine residues of the mature peptide. This chemokine, a member of the CC subfamily, displays chemotactic activity on resting T lymphocytes and monocytes, lower activity on neutrophils and no activity on activated T lymphocytes. The protein is also a strong suppressor of colony formation by a multipotential hematopoietic progenitor cell line. In addition, the product of this gene is a potent agonist of the chemokine (C-C motif) receptor 1. Alternative splicing results in multiple transcript variants that encode different isoforms. [provided by RefSeq, Jul 2013]
dog(480602) chemokine (C-C motif) ligand 23
domestic cat(101086516) chemokine (C-C motif) ligand 23
sheep(101114790) chemokine (C-C motif) ligand 23
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_005064 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_005064 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_005064 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU121021 MISSION® esiRNA esiRNA human CCL23 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_005064 Rosetta Predictions human pricing
NM_145898 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_005064 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00163484 predicted 197
2 SASI_Hs01_00163485 predicted 312
3 SASI_Hs01_00163486 predicted 237
4 SASI_Hs01_00163487 predicted 230
5 SASI_Hs01_00163488 predicted 211
6 SASI_Hs01_00163489 predicted 251
7 SASI_Hs01_00163490 predicted 228
8 SASI_Hs01_00163491 predicted 215
9 SASI_Hs01_00163492 predicted 216
10 SASI_Hs01_00163493 predicted 254
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_145898 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00057949 predicted 260
2 SASI_Hs01_00057951 predicted 310
3 SASI_Hs01_00057952 predicted 257
4 SASI_Hs01_00057953 predicted 265
5 SASI_Hs01_00057954 predicted 305
6 SASI_Hs01_00057955 predicted 201
7 SASI_Hs01_00057956 predicted 198
8 SASI_Hs01_00057957 predicted 263
9 SASI_Hs01_00057958 predicted 195
10 SASI_Hs02_00365411 predicted 255
11 SASI_Hs01_00057950 predicted 202
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_005064
CCL23 MISSION shRNA Bacterial Glycerol Stock
chemokine (C-C motif) ligand 23
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000371676    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005064.3-319s21c1
Sequence:CCGGCACTCCTGGAGAGTTACTTTGCTCGAGCAAAGTAACTCTCCAGGAGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000371677    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005064.3-449s21c1
Sequence:CCGGGAAGCTGGACACACGGATCAACTCGAGTTGATCCGTGTGTCCAGCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000371612    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005064.3-192s21c1
Sequence:CCGGCCAGTACTTCTGGACATGCTCCTCGAGGAGCATGTCCAGAAGTACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000057868    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005064.3-489s1c1
Sequence:CCGGTGTCAAGGTGAAGGGACACAACTCGAGTTGTGTCCCTTCACCTTGACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000057870    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005064.3-425s1c1
Sequence:CCGGAGTTCAGGTTTGCGTGAGAATCTCGAGATTCTCACGCAAACCTGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000057871    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005064.3-218s1c1
Sequence:CCGGGAGAAAGATTGGTCCTCAGATCTCGAGATCTGAGGACCAATCTTTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000057872    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005064.3-253s1c1
Sequence:CCGGCTGCAGGATTCCATGCTACTACTCGAGTAGTAGCATGGAATCCTGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000057869    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005064.3-242s1c1
Sequence:CCGGCCTTTCTCATGCTGCAGGATTCTCGAGAATCCTGCAGCATGAGAAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_005064
CCL23 MISSION shRNA shRNA Plasmid DNA
chemokine (C-C motif) ligand 23
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000371676    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005064.3-319s21c1
Sequence:CCGGCACTCCTGGAGAGTTACTTTGCTCGAGCAAAGTAACTCTCCAGGAGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000371677    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005064.3-449s21c1
Sequence:CCGGGAAGCTGGACACACGGATCAACTCGAGTTGATCCGTGTGTCCAGCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000371612    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005064.3-192s21c1
Sequence:CCGGCCAGTACTTCTGGACATGCTCCTCGAGGAGCATGTCCAGAAGTACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000057868    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005064.3-489s1c1
Sequence:CCGGTGTCAAGGTGAAGGGACACAACTCGAGTTGTGTCCCTTCACCTTGACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000057870    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005064.3-425s1c1
Sequence:CCGGAGTTCAGGTTTGCGTGAGAATCTCGAGATTCTCACGCAAACCTGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000057871    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005064.3-218s1c1
Sequence:CCGGGAGAAAGATTGGTCCTCAGATCTCGAGATCTGAGGACCAATCTTTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000057872    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005064.3-253s1c1
Sequence:CCGGCTGCAGGATTCCATGCTACTACTCGAGTAGTAGCATGGAATCCTGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000057869    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005064.3-242s1c1
Sequence:CCGGCCTTTCTCATGCTGCAGGATTCTCGAGAATCCTGCAGCATGAGAAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_005064
CCL23 MISSION shRNA Lentiviral Transduction Particles
chemokine (C-C motif) ligand 23
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000371676    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005064.3-319s21c1
Sequence:CCGGCACTCCTGGAGAGTTACTTTGCTCGAGCAAAGTAACTCTCCAGGAGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000371677    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005064.3-449s21c1
Sequence:CCGGGAAGCTGGACACACGGATCAACTCGAGTTGATCCGTGTGTCCAGCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000371612    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005064.3-192s21c1
Sequence:CCGGCCAGTACTTCTGGACATGCTCCTCGAGGAGCATGTCCAGAAGTACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000057868    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005064.3-489s1c1
Sequence:CCGGTGTCAAGGTGAAGGGACACAACTCGAGTTGTGTCCCTTCACCTTGACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000057870    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005064.3-425s1c1
Sequence:CCGGAGTTCAGGTTTGCGTGAGAATCTCGAGATTCTCACGCAAACCTGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000057871    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005064.3-218s1c1
Sequence:CCGGGAGAAAGATTGGTCCTCAGATCTCGAGATCTGAGGACCAATCTTTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000057872    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005064.3-253s1c1
Sequence:CCGGCTGCAGGATTCCATGCTACTACTCGAGTAGTAGCATGGAATCCTGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000057869    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005064.3-242s1c1
Sequence:CCGGCCTTTCTCATGCTGCAGGATTCTCGAGAATCCTGCAGCATGAGAAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks