EMAIL THIS PAGE TO A FRIEND

CCL24

chemokine (C-C motif) ligand 24

Synonyms: Ckb-6 MPIF-2 MPIF2 SCYA24
UniProtKB ID: O00175, B2R5K2
Gene ID:
Human(6369) Summary: This gene belongs to the subfamily of small cytokine CC genes. Cytokines are a family of secreted proteins involved in immunoregulatory and inflammatory processes. The CC cytokines are proteins characterized by two adjacent cysteines. The cytokine encoded by this gene displays chemotactic activity on resting T lymphocytes, a minimal activity on neutrophils, and is negative on monocytes and activated T lymphocytes. The protein is also a strong suppressor of colony formation by a multipotential hematopoietic progenitor cell line. [provided by RefSeq, Jul 2008]
Mouse(56221) chemokine (C-C motif) ligand 24
Rat(288593) chemokine (C-C motif) ligand 24
sheep(101117556) chemokine (C-C motif) ligand 24
naked mole-rat(101711238) chemokine (C-C motif) ligand 24
dog(445452) chemokine (C-C motif) ligand 24
domestic cat(101086275) chemokine (C-C motif) ligand 24
cow(617258) chemokine (C-C motif) ligand 24
68 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_002991 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_002991 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_002991 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_019577 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_019577 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_019577 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU058241 MISSION® esiRNA esiRNA human CCL24 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_002991 Rosetta Predictions human pricing
NM_001013045 Rosetta Predictions rat pricing
XM_213743 Rosetta Predictions rat pricing
NM_019577 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_002991 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00208654 predicted 117
2 SASI_Hs01_00208655 predicted 26
3 SASI_Hs01_00208656 predicted 308
4 SASI_Hs02_00334866 predicted 91
5 SASI_Hs01_00208657 predicted 239
6 SASI_Hs01_00208658 predicted 38
7 SASI_Hs02_00334867 predicted 92
8 SASI_Hs01_00208659 predicted 100
9 SASI_Hs01_00208660 predicted 323
10 SASI_Hs01_00208661 predicted 144
11 SASI_Hs01_00208662 predicted 28
12 SASI_Hs01_00208663 predicted 172
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001013045 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00042272 predicted 877
2 SASI_Rn01_00042275 predicted 763
3 SASI_Rn01_00042276 predicted 719
4 SASI_Rn01_00042277 predicted 811
5 SASI_Rn01_00042278 predicted 372
6 SASI_Rn01_00042279 predicted 779
7 SASI_Rn01_00042280 predicted 789
8 SASI_Rn01_00042281 predicted 354
9 SASI_Rn02_00200642 predicted 627
10 SASI_Rn02_00200643 predicted 320
11 SASI_Rn01_00042273 predicted 309
12 SASI_Rn01_00042274 predicted 295
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_213743 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00140617 predicted 277
2 SASI_Rn01_00140618 predicted 204
3 SASI_Rn01_00140619 predicted 242
4 SASI_Rn01_00140620 predicted 237
5 SASI_Rn01_00140621 predicted 243
6 SASI_Rn01_00140622 predicted 210
7 SASI_Rn01_00140623 predicted 242
8 SASI_Rn01_00140624 predicted 412
9 SASI_Rn01_00140625 predicted 90
10 SASI_Rn01_00140626 predicted 416
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_019577 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00324632 predicted 897
2 SASI_Mm02_00324633 predicted 826
3 SASI_Mm02_00324634 predicted 798
4 SASI_Mm02_00324635 predicted 397
5 SASI_Mm02_00324636 predicted 470
6 SASI_Mm02_00324637 predicted 833
7 SASI_Mm02_00324638 predicted 207
8 SASI_Mm02_00324639 predicted 744
9 SASI_Mm02_00324640 predicted 588
10 SASI_Mm02_00324641 predicted 650
11 SASI_Mm01_00100928 predicted 292
12 SASI_Mm01_00100929 predicted 299
13 SASI_Mm01_00100930 predicted 354
14 SASI_Mm01_00100931 predicted 250
15 SASI_Mm01_00100932 predicted 295
16 SASI_Mm01_00100933 predicted 293
17 SASI_Mm01_00100934 predicted 264
18 SASI_Mm01_00100935 predicted 255
19 SASI_Mm01_00100936 predicted 300
20 SASI_Mm01_00100937 predicted 358
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_002991
CCL24 MISSION shRNA Bacterial Glycerol Stock
chemokine (C-C motif) ligand 24
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000057903    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002991.2-95s1c1
Sequence:CCGGCCTGCTGCATGTTCTTTGTTTCTCGAGAAACAAAGAACATGCAGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000057906    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002991.2-159s1c1
Sequence:CCGGCAGCAGGAGCACATGCCTCAACTCGAGTTGAGGCATGTGCTCCTGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000057907    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002991.2-135s1c1
Sequence:CCGGCCGAGTGGTCAGCTACCAGCTCTCGAGAGCTGGTAGCTGACCACTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000057905    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002991.2-31s1c1
Sequence:CCGGCTTCTGTTCCTTGGTGTCTGTCTCGAGACAGACACCAAGGAACAGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000057904    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002991.2-105s1c1
Sequence:CCGGGTTCTTTGTTTCCAAGAGAATCTCGAGATTCTCTTGGAAACAAAGAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000377746    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002991.2-124s21c1
Sequence:CCGGATTCCTGAGAACCGAGTGGTCCTCGAGGACCACTCGGTTCTCAGGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000371614    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002991.2-186s21c1
Sequence:CCGGAGTGATCTTCACCACCAAGAACTCGAGTTCTTGGTGGTGAAGATCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000371615    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002991.2-45s21c1
Sequence:CCGGTGTCTGTGCCCACCACATCATCTCGAGATGATGTGGTGGGCACAGACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000371616    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002991.2-175s21c1
Sequence:CCGGCTCAAGGCAGGAGTGATCTTCCTCGAGGAAGATCACTCCTGCCTTGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_002991
CCL24 MISSION shRNA shRNA Plasmid DNA
chemokine (C-C motif) ligand 24
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000057903    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002991.2-95s1c1
Sequence:CCGGCCTGCTGCATGTTCTTTGTTTCTCGAGAAACAAAGAACATGCAGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000057906    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002991.2-159s1c1
Sequence:CCGGCAGCAGGAGCACATGCCTCAACTCGAGTTGAGGCATGTGCTCCTGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000057907    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002991.2-135s1c1
Sequence:CCGGCCGAGTGGTCAGCTACCAGCTCTCGAGAGCTGGTAGCTGACCACTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000057905    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002991.2-31s1c1
Sequence:CCGGCTTCTGTTCCTTGGTGTCTGTCTCGAGACAGACACCAAGGAACAGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000057904    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002991.2-105s1c1
Sequence:CCGGGTTCTTTGTTTCCAAGAGAATCTCGAGATTCTCTTGGAAACAAAGAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000377746    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002991.2-124s21c1
Sequence:CCGGATTCCTGAGAACCGAGTGGTCCTCGAGGACCACTCGGTTCTCAGGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000371614    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002991.2-186s21c1
Sequence:CCGGAGTGATCTTCACCACCAAGAACTCGAGTTCTTGGTGGTGAAGATCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000371615    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002991.2-45s21c1
Sequence:CCGGTGTCTGTGCCCACCACATCATCTCGAGATGATGTGGTGGGCACAGACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000371616    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002991.2-175s21c1
Sequence:CCGGCTCAAGGCAGGAGTGATCTTCCTCGAGGAAGATCACTCCTGCCTTGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_002991
CCL24 MISSION shRNA Lentiviral Transduction Particles
chemokine (C-C motif) ligand 24
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000057903    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002991.2-95s1c1
Sequence:CCGGCCTGCTGCATGTTCTTTGTTTCTCGAGAAACAAAGAACATGCAGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000057906    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002991.2-159s1c1
Sequence:CCGGCAGCAGGAGCACATGCCTCAACTCGAGTTGAGGCATGTGCTCCTGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000057907    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002991.2-135s1c1
Sequence:CCGGCCGAGTGGTCAGCTACCAGCTCTCGAGAGCTGGTAGCTGACCACTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000057905    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002991.2-31s1c1
Sequence:CCGGCTTCTGTTCCTTGGTGTCTGTCTCGAGACAGACACCAAGGAACAGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000057904    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002991.2-105s1c1
Sequence:CCGGGTTCTTTGTTTCCAAGAGAATCTCGAGATTCTCTTGGAAACAAAGAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000377746    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002991.2-124s21c1
Sequence:CCGGATTCCTGAGAACCGAGTGGTCCTCGAGGACCACTCGGTTCTCAGGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000371614    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002991.2-186s21c1
Sequence:CCGGAGTGATCTTCACCACCAAGAACTCGAGTTCTTGGTGGTGAAGATCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000371615    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002991.2-45s21c1
Sequence:CCGGTGTCTGTGCCCACCACATCATCTCGAGATGATGTGGTGGGCACAGACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000371616    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002991.2-175s21c1
Sequence:CCGGCTCAAGGCAGGAGTGATCTTCCTCGAGGAAGATCACTCCTGCCTTGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_019577
CCL24 MISSION shRNA Bacterial Glycerol Stock
chemokine (C-C motif) ligand 24
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000067878    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019577.2-248s1c1
Sequence:CCGGCATCACCAAGAAGGGCCATAACTCGAGTTATGGCCCTTCTTGGTGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000067879    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019577.2-156s1c1
Sequence:CCGGACGTCCTTTATTTCCAAGAAACTCGAGTTTCTTGGAAATAAAGGACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000067880    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019577.2-390s1c1
Sequence:CCGGCGTGGCAATAGCACCGAGGTTCTCGAGAACCTCGGTGCTATTGCCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000067882    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019577.2-291s1c1
Sequence:CCGGCTGTGGGTTCAGAGGCACATACTCGAGTATGTGCCTCTGAACCCACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000067881    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019577.2-188s1c1
Sequence:CCGGCCGAGTGGTTAGCTACCAGTTCTCGAGAACTGGTAGCTAACCACTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_019577
CCL24 MISSION shRNA shRNA Plasmid DNA
chemokine (C-C motif) ligand 24
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000067878    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019577.2-248s1c1
Sequence:CCGGCATCACCAAGAAGGGCCATAACTCGAGTTATGGCCCTTCTTGGTGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000067879    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019577.2-156s1c1
Sequence:CCGGACGTCCTTTATTTCCAAGAAACTCGAGTTTCTTGGAAATAAAGGACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000067880    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019577.2-390s1c1
Sequence:CCGGCGTGGCAATAGCACCGAGGTTCTCGAGAACCTCGGTGCTATTGCCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000067882    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019577.2-291s1c1
Sequence:CCGGCTGTGGGTTCAGAGGCACATACTCGAGTATGTGCCTCTGAACCCACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000067881    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019577.2-188s1c1
Sequence:CCGGCCGAGTGGTTAGCTACCAGTTCTCGAGAACTGGTAGCTAACCACTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_019577
CCL24 MISSION shRNA Lentiviral Transduction Particles
chemokine (C-C motif) ligand 24
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000067878    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019577.2-248s1c1
Sequence:CCGGCATCACCAAGAAGGGCCATAACTCGAGTTATGGCCCTTCTTGGTGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000067879    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019577.2-156s1c1
Sequence:CCGGACGTCCTTTATTTCCAAGAAACTCGAGTTTCTTGGAAATAAAGGACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000067880    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019577.2-390s1c1
Sequence:CCGGCGTGGCAATAGCACCGAGGTTCTCGAGAACCTCGGTGCTATTGCCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000067882    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019577.2-291s1c1
Sequence:CCGGCTGTGGGTTCAGAGGCACATACTCGAGTATGTGCCTCTGAACCCACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000067881    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019577.2-188s1c1
Sequence:CCGGCCGAGTGGTTAGCTACCAGTTCTCGAGAACTGGTAGCTAACCACTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks