EMAIL THIS PAGE TO A FRIEND

CCL25

chemokine (C-C motif) ligand 25

54 Gene Product Result for
Synonyms: Ckb15 SCYA25 TECK
UniProtKB ID: O15444, A1L4J4, A6NI52, A8K9E7, B5MCA5, Q96KJ7
Gene ID:
Human(6370) Summary: This gene belongs to the subfamily of small cytokine CC genes. Cytokines are a family of secreted proteins involved in immunoregulatory and inflammatory processes. The CC cytokines are proteins characterized by two adjacent cysteines. The cytokine encoded by this gene displays chemotactic activity for dendritic cells, thymocytes, and activated macrophages but is inactive on peripheral blood lymphocytes and neutrophils. The product of this gene binds to chemokine receptor CCR9. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Feb 2011]
Mouse(20300) chemokine (C-C motif) ligand 25
Rat(360750) chemokine (C-C motif) ligand 25
dog(448798) chemokine (C-C motif) ligand 25
cow(615986) chemokine (C-C motif) ligand 25
domestic guinea pig(100712598) chemokine (C-C motif) ligand 25
sheep(678679) chemokine (C-C motif) ligand 25
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_005624 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_005624 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_005624 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_009138 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_009138 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_009138 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_005624 Rosetta Predictions human pricing
NM_001037203 Rosetta Predictions rat pricing
NM_009138 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_005624 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00217759 predicted 261
2 SASI_Hs01_00217760 predicted 364
3 SASI_Hs01_00217761 predicted 371
4 SASI_Hs01_00217762 predicted 328
5 SASI_Hs01_00217763 predicted 412
6 SASI_Hs02_00339948 predicted 266
7 SASI_Hs01_00217765 predicted 313
8 SASI_Hs01_00217766 predicted 447
9 SASI_Hs01_00217767 predicted 423
10 SASI_Hs02_00339949 predicted 334
11 SASI_Hs01_00217764 predicted 423
12 SASI_Hs01_00217768 predicted 581
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001037203 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00054632 predicted 281
2 SASI_Rn01_00054633 predicted 516
3 SASI_Rn01_00054634 predicted 528
4 SASI_Rn01_00054635 predicted 504
5 SASI_Rn01_00054636 predicted 494
6 SASI_Rn01_00054637 predicted 514
7 SASI_Rn02_00204313 predicted 422
8 SASI_Rn01_00054638 predicted 259
9 SASI_Rn01_00054639 predicted 232
10 SASI_Rn01_00054641 predicted 521
11 SASI_Rn01_00054640 predicted 416
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_009138 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00172889 predicted 261
2 SASI_Mm01_00172890 predicted 288
3 SASI_Mm02_00315440 predicted 314
4 SASI_Mm01_00172892 predicted 328
5 SASI_Mm01_00172893 predicted 311
6 SASI_Mm01_00172894 predicted 514
7 SASI_Mm01_00172895 predicted 478
8 SASI_Mm01_00172896 predicted 299
9 SASI_Mm01_00172897 predicted 511
10 SASI_Mm01_00172898 predicted 279
11 SASI_Mm01_00172891 predicted 510
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_005624
CCL25 MISSION shRNA Bacterial Glycerol Stock
chemokine (C-C motif) ligand 25
Human
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000436312    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005624.2-335s21c1
Sequence:CCGGATGCTGTAAAGAAGTTGAGTTCTCGAGAACTCAACTTCTTTACAGCATTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000432469    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005624.2-564s21c1
Sequence:CCGGCTTAATCCCTGCACCTGAGTTCTCGAGAACTCAGGTGCAGGGATTAAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000421041    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005624.2-703s21c1
Sequence:CCGGGCTCTTGTAGAGAAGACTTAGCTCGAGCTAAGTCTTCTCTACAAGAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000058010    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005624.2-264s1c1
Sequence:CCGGGCTCCTGGATGCTCGAAATAACTCGAGTTATTTCGAGCATCCAGGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000058012    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005624.2-390s1c1
Sequence:CCGGCAATCCCATCAGCAGCAGTAACTCGAGTTACTGCTGCTGATGGGATTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000058011    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005624.2-366s1c1
Sequence:CCGGCAAGTTATCATCGTCCAAGTTCTCGAGAACTTGGACGATGATAACTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_005624
CCL25 MISSION shRNA shRNA Plasmid DNA
chemokine (C-C motif) ligand 25
Human
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000436312    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005624.2-335s21c1
Sequence:CCGGATGCTGTAAAGAAGTTGAGTTCTCGAGAACTCAACTTCTTTACAGCATTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000432469    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005624.2-564s21c1
Sequence:CCGGCTTAATCCCTGCACCTGAGTTCTCGAGAACTCAGGTGCAGGGATTAAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000421041    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005624.2-703s21c1
Sequence:CCGGGCTCTTGTAGAGAAGACTTAGCTCGAGCTAAGTCTTCTCTACAAGAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000058010    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005624.2-264s1c1
Sequence:CCGGGCTCCTGGATGCTCGAAATAACTCGAGTTATTTCGAGCATCCAGGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000058012    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005624.2-390s1c1
Sequence:CCGGCAATCCCATCAGCAGCAGTAACTCGAGTTACTGCTGCTGATGGGATTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000058011    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005624.2-366s1c1
Sequence:CCGGCAAGTTATCATCGTCCAAGTTCTCGAGAACTTGGACGATGATAACTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_005624
CCL25 MISSION shRNA Lentiviral Transduction Particles
chemokine (C-C motif) ligand 25
Human
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000436312    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005624.2-335s21c1
Sequence:CCGGATGCTGTAAAGAAGTTGAGTTCTCGAGAACTCAACTTCTTTACAGCATTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000432469    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005624.2-564s21c1
Sequence:CCGGCTTAATCCCTGCACCTGAGTTCTCGAGAACTCAGGTGCAGGGATTAAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000421041    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005624.2-703s21c1
Sequence:CCGGGCTCTTGTAGAGAAGACTTAGCTCGAGCTAAGTCTTCTCTACAAGAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000058010    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005624.2-264s1c1
Sequence:CCGGGCTCCTGGATGCTCGAAATAACTCGAGTTATTTCGAGCATCCAGGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000058012    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005624.2-390s1c1
Sequence:CCGGCAATCCCATCAGCAGCAGTAACTCGAGTTACTGCTGCTGATGGGATTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000058011    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005624.2-366s1c1
Sequence:CCGGCAAGTTATCATCGTCCAAGTTCTCGAGAACTTGGACGATGATAACTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_009138
VALIDATED
CCL25 MISSION shRNA Bacterial Glycerol Stock
chemokine (C-C motif) ligand 25
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000334297    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_009138.2-295s21c1
Sequence:CCGGCCAGAAAGTAGTGTGTGGGAACTCGAGTTCCCACACACTACTTTCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000334296    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_009138.2-281s21c1
Sequence:CCGGAGATTCTACTTCCGCCAGAAACTCGAGTTTCTGGCGGAAGTAGAATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000334295    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_009138.2-193s21c1
Sequence:CCGGCCAGCACAGGATCAAATGGAACTCGAGTTCCATTTGATCCTGTGCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000348238    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.87 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_009138.2-822s21c1
Sequence:CCGGTCAGGCAAGCAACCCTAATTACTCGAGTAATTAGGGTTGCTTGCCTGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000375753    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.81 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_009138.2-733s21c1
Sequence:CCGGGCTGAGGGAAGGGAGTAATTTCTCGAGAAATTACTCCCTTCCCTCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000067913    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_009138.1-505s1c1
Sequence:CCGGGCCCAGAAAGACCAACAATTACTCGAGTAATTGTTGGTCTTTCTGGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000067917    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_009138.1-281s1c1
Sequence:CCGGAGATTCTACTTCCGCCAGAAACTCGAGTTTCTGGCGGAAGTAGAATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000067914    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_009138.1-193s1c1
Sequence:CCGGCCAGCACAGGATCAAATGGAACTCGAGTTCCATTTGATCCTGTGCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000067916    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009138.1-341s1c1
Sequence:CCGGGCGATGAGAATCTTGACAGCTCTCGAGAGCTGTCAAGATTCTCATCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000067915    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_009138.1-295s1c1
Sequence:CCGGCCAGAAAGTAGTGTGTGGGAACTCGAGTTCCCACACACTACTTTCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_009138
VALIDATED
CCL25 MISSION shRNA shRNA Plasmid DNA
chemokine (C-C motif) ligand 25
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000334297    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_009138.2-295s21c1
Sequence:CCGGCCAGAAAGTAGTGTGTGGGAACTCGAGTTCCCACACACTACTTTCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000334296    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_009138.2-281s21c1
Sequence:CCGGAGATTCTACTTCCGCCAGAAACTCGAGTTTCTGGCGGAAGTAGAATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000334295    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_009138.2-193s21c1
Sequence:CCGGCCAGCACAGGATCAAATGGAACTCGAGTTCCATTTGATCCTGTGCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000348238    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.87 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_009138.2-822s21c1
Sequence:CCGGTCAGGCAAGCAACCCTAATTACTCGAGTAATTAGGGTTGCTTGCCTGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000375753    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.81 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_009138.2-733s21c1
Sequence:CCGGGCTGAGGGAAGGGAGTAATTTCTCGAGAAATTACTCCCTTCCCTCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000067913    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_009138.1-505s1c1
Sequence:CCGGGCCCAGAAAGACCAACAATTACTCGAGTAATTGTTGGTCTTTCTGGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000067917    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_009138.1-281s1c1
Sequence:CCGGAGATTCTACTTCCGCCAGAAACTCGAGTTTCTGGCGGAAGTAGAATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000067914    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_009138.1-193s1c1
Sequence:CCGGCCAGCACAGGATCAAATGGAACTCGAGTTCCATTTGATCCTGTGCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000067916    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009138.1-341s1c1
Sequence:CCGGGCGATGAGAATCTTGACAGCTCTCGAGAGCTGTCAAGATTCTCATCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000067915    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_009138.1-295s1c1
Sequence:CCGGCCAGAAAGTAGTGTGTGGGAACTCGAGTTCCCACACACTACTTTCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_009138
VALIDATED
CCL25 MISSION shRNA Lentiviral Transduction Particles
chemokine (C-C motif) ligand 25
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000334297    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_009138.2-295s21c1
Sequence:CCGGCCAGAAAGTAGTGTGTGGGAACTCGAGTTCCCACACACTACTTTCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000334296    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_009138.2-281s21c1
Sequence:CCGGAGATTCTACTTCCGCCAGAAACTCGAGTTTCTGGCGGAAGTAGAATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000334295    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_009138.2-193s21c1
Sequence:CCGGCCAGCACAGGATCAAATGGAACTCGAGTTCCATTTGATCCTGTGCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000348238    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.87 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_009138.2-822s21c1
Sequence:CCGGTCAGGCAAGCAACCCTAATTACTCGAGTAATTAGGGTTGCTTGCCTGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000375753    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.81 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_009138.2-733s21c1
Sequence:CCGGGCTGAGGGAAGGGAGTAATTTCTCGAGAAATTACTCCCTTCCCTCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000067913    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_009138.1-505s1c1
Sequence:CCGGGCCCAGAAAGACCAACAATTACTCGAGTAATTGTTGGTCTTTCTGGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000067917    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_009138.1-281s1c1
Sequence:CCGGAGATTCTACTTCCGCCAGAAACTCGAGTTTCTGGCGGAAGTAGAATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000067914    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_009138.1-193s1c1
Sequence:CCGGCCAGCACAGGATCAAATGGAACTCGAGTTCCATTTGATCCTGTGCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000067916    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009138.1-341s1c1
Sequence:CCGGGCGATGAGAATCTTGACAGCTCTCGAGAGCTGTCAAGATTCTCATCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000067915    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_009138.1-295s1c1
Sequence:CCGGCCAGAAAGTAGTGTGTGGGAACTCGAGTTCCCACACACTACTTTCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)