EMAIL THIS PAGE TO A FRIEND

CCL26

chemokine (C-C motif) ligand 26

58 Gene Product Result for
Synonyms: IMAC MIP-4a MIP-4alpha SCYA26 TSC-1
UniProtKB ID: Q9Y258, A0N0Q5, Q52LV8
Gene ID:
Human(10344) Summary: This gene is one of two Cys-Cys (CC) cytokine genes clustered on the q arm of chromosome 7. Cytokines are a family of secreted proteins involved in immunoregulatory and inflammatory processes. The CC cytokines are proteins characterized by two adjacent cysteines. The cytokine encoded by this gene displays chemotactic activity for normal peripheral blood eosinophils and basophils. The product of this gene is one of three related chemokines that specifically activate chemokine receptor CCR3. This chemokine may contribute to the eosinophil accumulation in atopic diseases. [provided by RefSeq, Jul 2008]
Mouse(541307) chemokine (C-C motif) ligand 26
Rat(685958) chemokine (C-C motif) ligand 26
domestic cat(101086525) chemokine (C-C motif) ligand 26
cow(508387) chemokine (C-C motif) ligand 26
dog(448789) chemokine (C-C motif) ligand 26
sheep(101117297) chemokine (C-C motif) ligand 26
domestic guinea pig(101789361) chemokine (C-C motif) ligand 26
naked mole-rat(101717031) chemokine (C-C motif) ligand 26
Gene Class: Cytokines_and_Chemokines
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

ELISA

Product # Description Species Add to Cart
 
RAB0653 Human CCL26 / C-C Motif Chemokine 26 ELISA Kit human pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_006072 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_006072 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_006072 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001013412 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001013412 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001013412 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU025271 MISSION® esiRNA esiRNA human CCL26 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_006072 Rosetta Predictions human pricing
NM_001109488 Rosetta Predictions rat pricing
NM_001013412 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_006072 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00169873 predicted 226
2 SASI_Hs01_00169874 predicted 283
3 SASI_Hs01_00169875 predicted 236
4 SASI_Hs01_00169876 predicted 248
5 SASI_Hs01_00169877 predicted 316
6 SASI_Hs01_00169878 predicted 280
7 SASI_Hs01_00169879 predicted 239
8 SASI_Hs01_00169880 predicted 273
9 SASI_Hs01_00169881 predicted 273
10 SASI_Hs02_00340840 predicted 308
11 SASI_Hs01_00169882 predicted 250
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001109488 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00248889 predicted 274
2 SASI_Rn02_00248890 predicted 196
3 SASI_Rn02_00248891 predicted 239
4 SASI_Rn02_00248892 predicted 241
5 SASI_Rn02_00248893 predicted 235
6 SASI_Rn02_00248894 predicted 207
7 SASI_Rn02_00248895 predicted 241
8 SASI_Rn02_00248896 predicted 407
9 SASI_Rn02_00248897 predicted 82
10 SASI_Rn02_00248898 predicted 408
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001013412 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00108425 predicted 201
2 SASI_Mm01_00108420 predicted 130
3 SASI_Mm02_00287228 predicted 164
4 SASI_Mm01_00108421 predicted 95
5 SASI_Mm01_00108423 predicted 103
6 SASI_Mm01_00108424 predicted 115
7 SASI_Mm02_00287229 predicted 162
8 SASI_Mm01_00108426 predicted 137
9 SASI_Mm01_00108427 predicted 152
10 SASI_Mm01_00108429 predicted 134
11 SASI_Mm01_00108422 predicted 174
12 SASI_Mm01_00108428 predicted 180
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_006072
CCL26 MISSION shRNA Bacterial Glycerol Stock
chemokine (C-C motif) ligand 26
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000058018    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_006072.4-407s1c1
Sequence:CCGGTCATCCGAGGACGCTTGGACCCTCGAGGGTCCAAGCGTCCTCGGATGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000058021    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006072.4-243s1c1
Sequence:CCGGCTGGGTGCGAAGCTATGAATTCTCGAGAATTCATAGCTTCGCACCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000058022    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006072.4-317s1c1
Sequence:CCGGAGAAAGTCTGTACCCATCCAACTCGAGTTGGATGGGTACAGACTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000058020    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006072.4-207s1c1
Sequence:CCGGCTGCTTCCAATACAGCCACAACTCGAGTTGTGGCTGTATTGGAAGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000058019    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006072.4-289s1c1
Sequence:CCGGGCTGTGATATTCACTACCAAACTCGAGTTTGGTAGTGAATATCACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000371679    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006072.4-378s21c1
Sequence:CCGGTCCGAAACAATTGTGACTCAGCTCGAGCTGAGTCACAATTGTTTCGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000371618    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006072.4-190s21c1
Sequence:CCGGGACATATCCAAGACCTGCTGCCTCGAGGCAGCAGGTCTTGGATATGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000371680    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006072.4-177s21c1
Sequence:CCGGCACACGTGGGAGTGACATATCCTCGAGGATATGTCACTCCCACGTGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000371681    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006072.4-155s21c1
Sequence:CCGGTGAGTCTCCACCTTGGAACTGCTCGAGCAGTTCCAAGGTGGAGACTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_006072
CCL26 MISSION shRNA shRNA Plasmid DNA
chemokine (C-C motif) ligand 26
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000058018    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_006072.4-407s1c1
Sequence:CCGGTCATCCGAGGACGCTTGGACCCTCGAGGGTCCAAGCGTCCTCGGATGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000058021    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006072.4-243s1c1
Sequence:CCGGCTGGGTGCGAAGCTATGAATTCTCGAGAATTCATAGCTTCGCACCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000058022    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006072.4-317s1c1
Sequence:CCGGAGAAAGTCTGTACCCATCCAACTCGAGTTGGATGGGTACAGACTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000058020    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006072.4-207s1c1
Sequence:CCGGCTGCTTCCAATACAGCCACAACTCGAGTTGTGGCTGTATTGGAAGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000058019    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006072.4-289s1c1
Sequence:CCGGGCTGTGATATTCACTACCAAACTCGAGTTTGGTAGTGAATATCACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000371679    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006072.4-378s21c1
Sequence:CCGGTCCGAAACAATTGTGACTCAGCTCGAGCTGAGTCACAATTGTTTCGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000371618    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006072.4-190s21c1
Sequence:CCGGGACATATCCAAGACCTGCTGCCTCGAGGCAGCAGGTCTTGGATATGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000371680    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006072.4-177s21c1
Sequence:CCGGCACACGTGGGAGTGACATATCCTCGAGGATATGTCACTCCCACGTGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000371681    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006072.4-155s21c1
Sequence:CCGGTGAGTCTCCACCTTGGAACTGCTCGAGCAGTTCCAAGGTGGAGACTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_006072
CCL26 MISSION shRNA Lentiviral Transduction Particles
chemokine (C-C motif) ligand 26
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000058018    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_006072.4-407s1c1
Sequence:CCGGTCATCCGAGGACGCTTGGACCCTCGAGGGTCCAAGCGTCCTCGGATGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000058021    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006072.4-243s1c1
Sequence:CCGGCTGGGTGCGAAGCTATGAATTCTCGAGAATTCATAGCTTCGCACCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000058022    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006072.4-317s1c1
Sequence:CCGGAGAAAGTCTGTACCCATCCAACTCGAGTTGGATGGGTACAGACTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000058020    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006072.4-207s1c1
Sequence:CCGGCTGCTTCCAATACAGCCACAACTCGAGTTGTGGCTGTATTGGAAGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000058019    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006072.4-289s1c1
Sequence:CCGGGCTGTGATATTCACTACCAAACTCGAGTTTGGTAGTGAATATCACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000371679    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006072.4-378s21c1
Sequence:CCGGTCCGAAACAATTGTGACTCAGCTCGAGCTGAGTCACAATTGTTTCGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000371618    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006072.4-190s21c1
Sequence:CCGGGACATATCCAAGACCTGCTGCCTCGAGGCAGCAGGTCTTGGATATGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000371680    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006072.4-177s21c1
Sequence:CCGGCACACGTGGGAGTGACATATCCTCGAGGATATGTCACTCCCACGTGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000371681    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006072.4-155s21c1
Sequence:CCGGTGAGTCTCCACCTTGGAACTGCTCGAGCAGTTCCAAGGTGGAGACTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001013412
CCL26 MISSION shRNA Bacterial Glycerol Stock
chemokine (C-C motif) ligand 26
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000089388    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001013412.1-96s1c1
Sequence:CCGGCTGCCCTAATTTCAGCTACTACTCGAGTAGTAGCTGAAATTAGGGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000089391    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001013412.1-110s1c1
Sequence:CCGGGCTACTATGTGATCCCATGGACTCGAGTCCATGGGATCACATAGTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000089392    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001013412.1-69s1c1
Sequence:CCGGAGGTGGAAGCAGCATCGCTATCTCGAGATAGCGATGCTGCTTCCACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000089389    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001013412.1-132s1c1
Sequence:CCGGCTGGGTGTACAGCTATAAGTTCTCGAGAACTTATAGCTGTACACCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000089390    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001013412.1-84s1c1
Sequence:CCGGCGCTATGTCCTGCTGCCCTAACTCGAGTTAGGGCAGCAGGACATAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001013412
CCL26 MISSION shRNA shRNA Plasmid DNA
chemokine (C-C motif) ligand 26
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000089388    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001013412.1-96s1c1
Sequence:CCGGCTGCCCTAATTTCAGCTACTACTCGAGTAGTAGCTGAAATTAGGGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000089391    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001013412.1-110s1c1
Sequence:CCGGGCTACTATGTGATCCCATGGACTCGAGTCCATGGGATCACATAGTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000089392    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001013412.1-69s1c1
Sequence:CCGGAGGTGGAAGCAGCATCGCTATCTCGAGATAGCGATGCTGCTTCCACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000089389    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001013412.1-132s1c1
Sequence:CCGGCTGGGTGTACAGCTATAAGTTCTCGAGAACTTATAGCTGTACACCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000089390    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001013412.1-84s1c1
Sequence:CCGGCGCTATGTCCTGCTGCCCTAACTCGAGTTAGGGCAGCAGGACATAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001013412
CCL26 MISSION shRNA Lentiviral Transduction Particles
chemokine (C-C motif) ligand 26
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000089388    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001013412.1-96s1c1
Sequence:CCGGCTGCCCTAATTTCAGCTACTACTCGAGTAGTAGCTGAAATTAGGGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000089391    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001013412.1-110s1c1
Sequence:CCGGGCTACTATGTGATCCCATGGACTCGAGTCCATGGGATCACATAGTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000089392    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001013412.1-69s1c1
Sequence:CCGGAGGTGGAAGCAGCATCGCTATCTCGAGATAGCGATGCTGCTTCCACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000089389    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001013412.1-132s1c1
Sequence:CCGGCTGGGTGTACAGCTATAAGTTCTCGAGAACTTATAGCTGTACACCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000089390    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001013412.1-84s1c1
Sequence:CCGGCGCTATGTCCTGCTGCCCTAACTCGAGTTAGGGCAGCAGGACATAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks