EMAIL THIS PAGE TO A FRIEND

CCL27

chemokine (C-C motif) ligand 27

45 Gene Product Result for
Synonyms: ALP CTACK CTAK ESKINE ILC PESKY SCYA27
UniProtKB ID: Q9Y4X3
Gene ID:
Human(10850) Summary: This gene is one of several CC cytokine genes clustered on the p-arm of chromosome 9. Cytokines are a family of secreted proteins involved in immunoregulatory and inflammatory processes. The CC cytokines are proteins characterized by two adjacent cysteines. The protein encoded by this gene is chemotactic for skin-associated memory T lymphocytes. This cytokine may also play a role in mediating homing of lymphocytes to cutaneous sites. It specifically binds to chemokine receptor 10 (CCR10). Studies of a similar murine protein indicate that these protein-receptor interactions have a pivotal role in T cell-mediated skin inflammation. [provided by RefSeq, Jul 2008]
Rat(362505) chemokine (C-C motif) ligand 27
naked mole-rat(101710135) chemokine (C-C motif) ligand 27
domestic guinea pig(101789071) chemokine (C-C motif) ligand 27
sheep(101120468) chemokine (C-C motif) ligand 27
dog(445454) chemokine (C-C motif) ligand 27
domestic cat(101086511) chemokine (C-C motif) ligand 27
cow(101902682) chemokine (C-C motif) ligand 27
Gene Class: Cytokines_and_Chemokines
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_006664 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_006664 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_006664 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_006664 Rosetta Predictions human pricing
NM_001108660 Rosetta Predictions rat pricing
XM_342823 Rosetta Predictions rat pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_006664 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00072926 predicted 115
2 SASI_Hs01_00072927 predicted 165
3 SASI_Hs01_00072928 predicted 342
4 SASI_Hs01_00072929 predicted 186
5 SASI_Hs01_00072932 predicted 96
6 SASI_Hs01_00072933 predicted 351
7 SASI_Hs01_00072934 predicted 241
8 SASI_Hs02_00342050 predicted 315
9 SASI_Hs02_00342051 predicted 311
10 SASI_Hs02_00342052 predicted 250
11 SASI_Hs01_00072925 predicted 199
12 SASI_Hs01_00072930 predicted 336
13 SASI_Hs01_00072931 predicted 335
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001108660 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00240815 predicted 536
2 SASI_Rn02_00240816 predicted 423
3 SASI_Rn02_00240817 predicted 570
4 SASI_Rn02_00240818 predicted 487
5 SASI_Rn02_00240819 predicted 464
6 SASI_Rn02_00240820 predicted 583
7 SASI_Rn02_00240821 predicted 324
8 SASI_Rn02_00240822 predicted 327
9 SASI_Rn02_00240823 predicted 546
10 SASI_Rn02_00240824 predicted 705
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_342823 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00164541 predicted 309
2 SASI_Rn01_00164542 predicted 255
3 SASI_Rn01_00164543 predicted 288
4 SASI_Rn01_00164544 predicted 348
5 SASI_Rn01_00164545 predicted 229
6 SASI_Rn01_00164546 predicted 258
7 SASI_Rn01_00164547 predicted 250
8 SASI_Rn01_00164548 predicted 210
9 SASI_Rn01_00164549 predicted 315
10 SASI_Rn01_00164550 predicted 236
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_006664
CCL27 MISSION shRNA Bacterial Glycerol Stock
chemokine (C-C motif) ligand 27
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000371682    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006664.2-203s21c1
Sequence:CCGGGAAGGTCATCCAGGTGGAACTCTCGAGAGTTCCACCTGGATGACCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000371620    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006664.2-258s21c1
Sequence:CCGGTTCGTGCTTCACCTGGCTCAACTCGAGTTGAGCCAGGTGAAGCACGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000371683    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006664.2-173s21c1
Sequence:CCGGCCGAAAGCCACTCTCAGACAACTCGAGTTGTCTGAGAGTGGCTTTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000371685    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006664.2-275s21c1
Sequence:CCGGTCAACGCAGCATCTGCATCCACTCGAGTGGATGCAGATGCTGCGTTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000057898    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006664.2-113s1c1
Sequence:CCGGCCCAGACCCTACAGCAGCATTCTCGAGAATGCTGCTGTAGGGTCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000057901    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006664.2-157s1c1
Sequence:CCGGGCTGTACTCAGCTCTACCGAACTCGAGTTCGGTAGAGCTGAGTACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000057902    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006664.2-185s1c1
Sequence:CCGGCTCAGACAAGCTACTGAGGAACTCGAGTTCCTCAGTAGCTTGTCTGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000057900    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006664.2-315s1c1
Sequence:CCGGTCACAGTGGTTTGAGCACCAACTCGAGTTGGTGCTCAAACCACTGTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000057899    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006664.2-191s1c1
Sequence:CCGGCAAGCTACTGAGGAAGGTCATCTCGAGATGACCTTCCTCAGTAGCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_006664
CCL27 MISSION shRNA shRNA Plasmid DNA
chemokine (C-C motif) ligand 27
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000371682    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006664.2-203s21c1
Sequence:CCGGGAAGGTCATCCAGGTGGAACTCTCGAGAGTTCCACCTGGATGACCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000371620    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006664.2-258s21c1
Sequence:CCGGTTCGTGCTTCACCTGGCTCAACTCGAGTTGAGCCAGGTGAAGCACGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000371683    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006664.2-173s21c1
Sequence:CCGGCCGAAAGCCACTCTCAGACAACTCGAGTTGTCTGAGAGTGGCTTTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000371685    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006664.2-275s21c1
Sequence:CCGGTCAACGCAGCATCTGCATCCACTCGAGTGGATGCAGATGCTGCGTTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000057898    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006664.2-113s1c1
Sequence:CCGGCCCAGACCCTACAGCAGCATTCTCGAGAATGCTGCTGTAGGGTCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000057901    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006664.2-157s1c1
Sequence:CCGGGCTGTACTCAGCTCTACCGAACTCGAGTTCGGTAGAGCTGAGTACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000057902    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006664.2-185s1c1
Sequence:CCGGCTCAGACAAGCTACTGAGGAACTCGAGTTCCTCAGTAGCTTGTCTGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000057900    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006664.2-315s1c1
Sequence:CCGGTCACAGTGGTTTGAGCACCAACTCGAGTTGGTGCTCAAACCACTGTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000057899    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006664.2-191s1c1
Sequence:CCGGCAAGCTACTGAGGAAGGTCATCTCGAGATGACCTTCCTCAGTAGCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_006664
CCL27 MISSION shRNA Lentiviral Transduction Particles
chemokine (C-C motif) ligand 27
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000371682    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006664.2-203s21c1
Sequence:CCGGGAAGGTCATCCAGGTGGAACTCTCGAGAGTTCCACCTGGATGACCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000371620    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006664.2-258s21c1
Sequence:CCGGTTCGTGCTTCACCTGGCTCAACTCGAGTTGAGCCAGGTGAAGCACGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000371683    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006664.2-173s21c1
Sequence:CCGGCCGAAAGCCACTCTCAGACAACTCGAGTTGTCTGAGAGTGGCTTTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000371685    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006664.2-275s21c1
Sequence:CCGGTCAACGCAGCATCTGCATCCACTCGAGTGGATGCAGATGCTGCGTTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000057898    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006664.2-113s1c1
Sequence:CCGGCCCAGACCCTACAGCAGCATTCTCGAGAATGCTGCTGTAGGGTCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000057901    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006664.2-157s1c1
Sequence:CCGGGCTGTACTCAGCTCTACCGAACTCGAGTTCGGTAGAGCTGAGTACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000057902    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006664.2-185s1c1
Sequence:CCGGCTCAGACAAGCTACTGAGGAACTCGAGTTCCTCAGTAGCTTGTCTGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000057900    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006664.2-315s1c1
Sequence:CCGGTCACAGTGGTTTGAGCACCAACTCGAGTTGGTGCTCAAACCACTGTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000057899    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006664.2-191s1c1
Sequence:CCGGCAAGCTACTGAGGAAGGTCATCTCGAGATGACCTTCCTCAGTAGCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks