EMAIL THIS PAGE TO A FRIEND

CCL28

chemokine (C-C motif) ligand 28

54 Gene Product Result for
Synonyms: CCK1 MEC SCYA28
UniProtKB ID: Q9NRJ3
Gene ID:
Human(56477) Summary: This gene belongs to the subfamily of small cytokine CC genes. Cytokines are a family of secreted proteins involved in immunoregulatory and inflammatory processes. The CC cytokines are proteins characterized by two adjacent cysteines. The cytokine encoded by this gene displays chemotactic activity for resting CD4 or CD8 T cells and eosinophils. The product of this gene binds to chemokine receptors CCR3 and CCR10. This chemokine may play a role in the physiology of extracutaneous epithelial tissues, including diverse mucosal organs. [provided by RefSeq, Jul 2008]
Mouse(56838) chemokine (C-C motif) ligand 28
Rat(114492) chemokine (C-C motif) ligand 28
naked mole-rat(101711298) chemokine (C-C motif) ligand 28
domestic guinea pig(100733416) chemokine (C-C motif) ligand 28
sheep(780500) chemokine (C-C motif) ligand 28
domestic cat(101091759) chemokine (C-C motif) ligand 28
cow(535328) chemokine (C-C motif) ligand 28
dog(448795) chemokine (C-C motif) ligand 28
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_020279 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_020279 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_020279 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_019846 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_019846 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_019846 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_148672 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_148672 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_148672 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_148672 Rosetta Predictions human pricing
NM_053700 Rosetta Predictions rat pricing
NM_020279 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_148672 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00102898 predicted 276
2 SASI_Hs01_00102899 predicted 292
3 SASI_Hs01_00102900 predicted 202
4 SASI_Hs01_00102901 predicted 382
5 SASI_Hs01_00102902 predicted 282
6 SASI_Hs01_00102903 predicted 414
7 SASI_Hs01_00102904 predicted 291
8 SASI_Hs01_00102905 predicted 300
9 SASI_Hs01_00102906 predicted 244
10 SASI_Hs02_00365593 predicted 286
11 SASI_Hs01_00102897 predicted 306
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_053700 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00103320 predicted 226
2 SASI_Rn02_00266466 predicted 303
3 SASI_Rn01_00103321 predicted 695
4 SASI_Rn01_00103322 predicted 250
5 SASI_Rn01_00103323 predicted 759
6 SASI_Rn01_00103324 predicted 578
7 SASI_Rn01_00103325 predicted 855
8 SASI_Rn01_00103327 predicted 438
9 SASI_Rn01_00103329 predicted 520
10 SASI_Rn02_00266467 predicted 664
11 SASI_Rn01_00103326 predicted 416
12 SASI_Rn01_00103328 predicted 232
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_020279 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00171162 predicted 238
2 SASI_Mm01_00171163 predicted 513
3 SASI_Mm01_00171164 predicted 420
4 SASI_Mm01_00171165 predicted 261
5 SASI_Mm01_00171166 predicted 455
6 SASI_Mm01_00171168 predicted 437
7 SASI_Mm01_00171169 predicted 456
8 SASI_Mm02_00325481 predicted 524
9 SASI_Mm01_00171170 predicted 237
10 SASI_Mm01_00171171 predicted 449
11 SASI_Mm01_00171167 predicted 311
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_020279
CCL28 MISSION shRNA Bacterial Glycerol Stock
chemokine (C-C motif) ligand 28
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000065743    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020279.2-241s1c1
Sequence:CCGGGCTGTCATCCTTCATGTTAAACTCGAGTTTAACATGAAGGATGACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000065746    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020279.2-316s1c1
Sequence:CCGGGCCTCAGAGGTAAAGAAGAATCTCGAGATTCTTCTTTACCTCTGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000065747    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020279.2-109s1c1
Sequence:CCGGCAAACCTCAGAAGCCATACTTCTCGAGAAGTATGGCTTCTGAGGTTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000065745    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020279.2-152s1c1
Sequence:CCGGCTGAGGTGTCTCATCATGTTTCTCGAGAAACATGATGAGACACCTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000065744    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020279.2-282s1c1
Sequence:CCGGCCCGCACAATCGTACTTTGAACTCGAGTTCAAAGTACGATTGTGCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_020279
CCL28 MISSION shRNA shRNA Plasmid DNA
chemokine (C-C motif) ligand 28
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000065743    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020279.2-241s1c1
Sequence:CCGGGCTGTCATCCTTCATGTTAAACTCGAGTTTAACATGAAGGATGACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000065746    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020279.2-316s1c1
Sequence:CCGGGCCTCAGAGGTAAAGAAGAATCTCGAGATTCTTCTTTACCTCTGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000065747    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020279.2-109s1c1
Sequence:CCGGCAAACCTCAGAAGCCATACTTCTCGAGAAGTATGGCTTCTGAGGTTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000065745    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020279.2-152s1c1
Sequence:CCGGCTGAGGTGTCTCATCATGTTTCTCGAGAAACATGATGAGACACCTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000065744    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020279.2-282s1c1
Sequence:CCGGCCCGCACAATCGTACTTTGAACTCGAGTTCAAAGTACGATTGTGCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_020279
CCL28 MISSION shRNA Lentiviral Transduction Particles
chemokine (C-C motif) ligand 28
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000065743    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020279.2-241s1c1
Sequence:CCGGGCTGTCATCCTTCATGTTAAACTCGAGTTTAACATGAAGGATGACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000065746    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020279.2-316s1c1
Sequence:CCGGGCCTCAGAGGTAAAGAAGAATCTCGAGATTCTTCTTTACCTCTGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000065747    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020279.2-109s1c1
Sequence:CCGGCAAACCTCAGAAGCCATACTTCTCGAGAAGTATGGCTTCTGAGGTTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000065745    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020279.2-152s1c1
Sequence:CCGGCTGAGGTGTCTCATCATGTTTCTCGAGAAACATGATGAGACACCTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000065744    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020279.2-282s1c1
Sequence:CCGGCCCGCACAATCGTACTTTGAACTCGAGTTCAAAGTACGATTGTGCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_019846
CCL28 MISSION shRNA Bacterial Glycerol Stock
chemokine (C-C motif) ligand 28
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000057973    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019846.3-149s1c1
Sequence:CCGGCGGAGGTTTCACATCATATTTCTCGAGAAATATGATGTGAAACCTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000057976    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019846.3-406s1c1
Sequence:CCGGCACGAAACATACGGCCATAAACTCGAGTTTATGGCCGTATGTTTCGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000057977    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019846.3-279s1c1
Sequence:CCGGCCCGCACAACCATACTGTTAACTCGAGTTAACAGTATGGTTGTGCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000057975    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019846.3-177s1c1
Sequence:CCGGGCTCCTGGAAAGAGTGAATATCTCGAGATATTCACTCTTTCCAGGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000057974    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019846.3-288s1c1
Sequence:CCGGCCATACTGTTAAGCAGTGGATCTCGAGATCCACTGCTTAACAGTATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_019846
CCL28 MISSION shRNA shRNA Plasmid DNA
chemokine (C-C motif) ligand 28
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000057973    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019846.3-149s1c1
Sequence:CCGGCGGAGGTTTCACATCATATTTCTCGAGAAATATGATGTGAAACCTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000057976    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019846.3-406s1c1
Sequence:CCGGCACGAAACATACGGCCATAAACTCGAGTTTATGGCCGTATGTTTCGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000057977    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019846.3-279s1c1
Sequence:CCGGCCCGCACAACCATACTGTTAACTCGAGTTAACAGTATGGTTGTGCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000057975    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019846.3-177s1c1
Sequence:CCGGGCTCCTGGAAAGAGTGAATATCTCGAGATATTCACTCTTTCCAGGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000057974    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019846.3-288s1c1
Sequence:CCGGCCATACTGTTAAGCAGTGGATCTCGAGATCCACTGCTTAACAGTATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_019846
CCL28 MISSION shRNA Lentiviral Transduction Particles
chemokine (C-C motif) ligand 28
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000057973    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019846.3-149s1c1
Sequence:CCGGCGGAGGTTTCACATCATATTTCTCGAGAAATATGATGTGAAACCTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000057976    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019846.3-406s1c1
Sequence:CCGGCACGAAACATACGGCCATAAACTCGAGTTTATGGCCGTATGTTTCGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000057977    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019846.3-279s1c1
Sequence:CCGGCCCGCACAACCATACTGTTAACTCGAGTTAACAGTATGGTTGTGCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000057975    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019846.3-177s1c1
Sequence:CCGGGCTCCTGGAAAGAGTGAATATCTCGAGATATTCACTCTTTCCAGGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000057974    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019846.3-288s1c1
Sequence:CCGGCCATACTGTTAAGCAGTGGATCTCGAGATCCACTGCTTAACAGTATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_148672
CCL28 MISSION shRNA Bacterial Glycerol Stock
chemokine (C-C motif) ligand 28
Human
2 Products Total
TRC Number Price Set Price (2)? Select
TRCN0000377747    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_148672.2-598s21c1
Sequence:CCGGTATGCAAATGTAGCCAATAATCTCGAGATTATTGGCTACATTTGCATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000371622    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_148672.2-451s21c1
Sequence:CCGGTTAGAGAGTCTACAGATAAATCTCGAGATTTATCTGTAGACTCTCTAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_148672
CCL28 MISSION shRNA shRNA Plasmid DNA
chemokine (C-C motif) ligand 28
Human
2 Products Total
TRC Number Vector Price Set Price (2)? Select
TRCN0000377747    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_148672.2-598s21c1
Sequence:CCGGTATGCAAATGTAGCCAATAATCTCGAGATTATTGGCTACATTTGCATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000371622    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_148672.2-451s21c1
Sequence:CCGGTTAGAGAGTCTACAGATAAATCTCGAGATTTATCTGTAGACTCTCTAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_148672
CCL28 MISSION shRNA Lentiviral Transduction Particles
chemokine (C-C motif) ligand 28
Human
2 Products Total
TRC Number Volume Titer Vector Price Set Price (2)? Select
TRCN0000377747    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_148672.2-598s21c1
Sequence:CCGGTATGCAAATGTAGCCAATAATCTCGAGATTATTGGCTACATTTGCATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000371622    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_148672.2-451s21c1
Sequence:CCGGTTAGAGAGTCTACAGATAAATCTCGAGATTTATCTGTAGACTCTCTAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks