EMAIL THIS PAGE TO A FRIEND

CCL2

chemokine (C-C motif) ligand 2

111 Gene Product Result for
Synonyms: GDCF-2 HC11 HSMCR30 MCAF MCP-1 MCP1 SCYA2 SMC-CF
UniProtKB ID: P13500, B2R4V3, Q9UDF3
Gene ID:
Human(6347) Summary: This gene is one of several cytokine genes clustered on the q-arm of chromosome 17. Cytokines are a family of secreted proteins involved in immunoregulatory and inflammatory processes. The protein encoded by this gene is structurally related to the CXC subfamily of cytokines. Members of this subfamily are characterized by two cysteines separated by a single amino acid. This cytokine displays chemotactic activity for monocytes and basophils but not for neutrophils or eosinophils. It has been implicated in the pathogenesis of diseases characterized by monocytic infiltrates, like psoriasis, rheumatoid arthritis and atherosclerosis. It binds to chemokine receptors CCR2 and CCR4. [provided by RefSeq, Jul 2008]
Mouse(20296) chemokine (C-C motif) ligand 2
Rat(24770) chemokine (C-C motif) ligand 2
naked mole-rat(101697988) chemokine (C-C motif) ligand 2
domestic guinea pig(100135494) chemokine (C-C motif) ligand 2
sheep(101120093) chemokine (C-C motif) ligand 2
Domestic Rabbit(100009130) chemokine (C-C motif) ligand 2
sheep(100294591) chemokine (C-C motif) ligand 2
dog(403981) chemokine (C-C motif) ligand 2
cow(281043) chemokine (C-C motif) ligand 2
Horse(100034136) chemokine (C-C motif) ligand 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

AQUA Peptides

Product # Description Species Add to Cart
 
AQ0096 AQUA Peptide ISVQ[R] Bordetella pertussis Tohama I, Pseudoalteromonas atlantica T6c, human pricing
AQ0097 AQUA Peptide EAVI[F]K cow, dog, human, pig pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_002982 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_002982 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_002982 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_011333 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_011333 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_011333 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_002982 siRNAs that have been validated in the lab human pricing
NM_031530 Rosetta Predictions rat pricing
NM_011333 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_002982 siRNAs that have been validated in the lab Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00024138 validated 244
2 SASI_Hs01_00024134 predicted 358
3 SASI_Hs02_00334860 predicted 352
4 SASI_Hs01_00024135 predicted 365
5 SASI_Hs01_00024136 predicted 375
6 SASI_Hs01_00024137 predicted 393
7 SASI_Hs01_00024140 predicted 385
8 SASI_Hs01_00024141 predicted 358
9 SASI_Hs01_00024142 predicted 386
10 SASI_Hs01_00024143 predicted 303
11 SASI_Hs02_00334861 predicted 349
12 SASI_Hs01_00024139 predicted 375
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_031530 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00108712 predicted 314
2 SASI_Rn01_00108713 predicted 445
3 SASI_Rn01_00108714 predicted 474
4 SASI_Rn01_00108716 predicted 539
5 SASI_Rn01_00108717 predicted 525
6 SASI_Rn01_00108718 predicted 361
7 SASI_Rn01_00108719 predicted 552
8 SASI_Rn01_00108720 predicted 311
9 SASI_Rn02_00264680 predicted 425
10 SASI_Rn01_00108721 predicted 428
11 SASI_Rn01_00108715 predicted 263
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_011333 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00172409 predicted 322
2 SASI_Mm02_00320446 predicted 575
3 SASI_Mm02_00320447 predicted 452
4 SASI_Mm02_00320448 predicted 483
5 SASI_Mm01_00172411 predicted 200
6 SASI_Mm02_00320449 predicted 533
7 SASI_Mm02_00320450 predicted 368
8 SASI_Mm02_00320451 predicted 441
9 SASI_Mm02_00320452 predicted 511
10 SASI_Mm02_00320453 predicted 485
11 SASI_Mm01_00172410 predicted 359
12 SASI_Mm01_00172412 predicted 323
13 SASI_Mm01_00172413 predicted 208
14 SASI_Mm01_00172414 predicted 327
15 SASI_Mm01_00172415 predicted 329
16 SASI_Mm01_00172416 predicted 350
17 SASI_Mm01_00172417 predicted 284
18 SASI_Mm01_00172418 predicted 238
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_002982
VALIDATED
CCL2 MISSION shRNA Bacterial Glycerol Stock
chemokine (C-C motif) ligand 2
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000381382    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 2 Clone ID:NM_002982.3-108s21c1
Sequence:GTACCGGTCATAGCAGCCACCTTCATTCCTCGAGGAATGAAGGTGGCTGCTATGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000338418    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 2 Clone ID:NM_002982.3-163s21c1
Sequence:CCGGCCCAGTCACCTGCTGTTATAACTCGAGTTATAACAGCAGGTGACTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000338479    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002982.3-174s21c1
Sequence:CCGGGCTGTTATAACTTCACCAATACTCGAGTATTGGTGAAGTTATAACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000338420    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 2 Clone ID:NM_002982.3-214s21c1
Sequence:CCGGGCTCGCGAGCTATAGAAGAATCTCGAGATTCTTCTATAGCTCGCGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000338480    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 2 Clone ID:NM_002982.3-472s21c1
Sequence:CCGGGATGTGAAACATTATGCCTTACTCGAGTAAGGCATAATGTTTCACATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000006279    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 1 Clone ID:NM_002982.2-470s1c1
Sequence:CCGGGATGTGAAACATTATGCCTTACTCGAGTAAGGCATAATGTTTCACATCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000006281    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 1 Clone ID:NM_002982.2-212s1c1
Sequence:CCGGGCTCGCGAGCTATAGAAGAATCTCGAGATTCTTCTATAGCTCGCGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000006283    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_002982.2-161s1c1
Sequence:CCGGCCCAGTCACCTGCTGTTATAACTCGAGTTATAACAGCAGGTGACTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000006282    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 1 Clone ID:NM_002982.2-258s1c1
Sequence:CCGGGCTGTGATCTTCAAGACCATTCTCGAGAATGGTCTTGAAGATCACAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_002982
VALIDATED
CCL2 MISSION shRNA shRNA Plasmid DNA
chemokine (C-C motif) ligand 2
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000381382    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 2 Clone ID:NM_002982.3-108s21c1
Sequence:GTACCGGTCATAGCAGCCACCTTCATTCCTCGAGGAATGAAGGTGGCTGCTATGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000338418    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 2 Clone ID:NM_002982.3-163s21c1
Sequence:CCGGCCCAGTCACCTGCTGTTATAACTCGAGTTATAACAGCAGGTGACTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000338479    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002982.3-174s21c1
Sequence:CCGGGCTGTTATAACTTCACCAATACTCGAGTATTGGTGAAGTTATAACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000338420    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 2 Clone ID:NM_002982.3-214s21c1
Sequence:CCGGGCTCGCGAGCTATAGAAGAATCTCGAGATTCTTCTATAGCTCGCGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000338480    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 2 Clone ID:NM_002982.3-472s21c1
Sequence:CCGGGATGTGAAACATTATGCCTTACTCGAGTAAGGCATAATGTTTCACATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000006279    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 1 Clone ID:NM_002982.2-470s1c1
Sequence:CCGGGATGTGAAACATTATGCCTTACTCGAGTAAGGCATAATGTTTCACATCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000006281    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 1 Clone ID:NM_002982.2-212s1c1
Sequence:CCGGGCTCGCGAGCTATAGAAGAATCTCGAGATTCTTCTATAGCTCGCGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000006283    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_002982.2-161s1c1
Sequence:CCGGCCCAGTCACCTGCTGTTATAACTCGAGTTATAACAGCAGGTGACTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000006282    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 1 Clone ID:NM_002982.2-258s1c1
Sequence:CCGGGCTGTGATCTTCAAGACCATTCTCGAGAATGGTCTTGAAGATCACAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_002982
VALIDATED
CCL2 MISSION shRNA Lentiviral Transduction Particles
chemokine (C-C motif) ligand 2
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000381382    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 2 Clone ID:NM_002982.3-108s21c1
Sequence:GTACCGGTCATAGCAGCCACCTTCATTCCTCGAGGAATGAAGGTGGCTGCTATGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000338418    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 2 Clone ID:NM_002982.3-163s21c1
Sequence:CCGGCCCAGTCACCTGCTGTTATAACTCGAGTTATAACAGCAGGTGACTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000338479    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002982.3-174s21c1
Sequence:CCGGGCTGTTATAACTTCACCAATACTCGAGTATTGGTGAAGTTATAACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000338420    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 2 Clone ID:NM_002982.3-214s21c1
Sequence:CCGGGCTCGCGAGCTATAGAAGAATCTCGAGATTCTTCTATAGCTCGCGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000338480    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 2 Clone ID:NM_002982.3-472s21c1
Sequence:CCGGGATGTGAAACATTATGCCTTACTCGAGTAAGGCATAATGTTTCACATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000006279    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 1 Clone ID:NM_002982.2-470s1c1
Sequence:CCGGGATGTGAAACATTATGCCTTACTCGAGTAAGGCATAATGTTTCACATCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000006281    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 1 Clone ID:NM_002982.2-212s1c1
Sequence:CCGGGCTCGCGAGCTATAGAAGAATCTCGAGATTCTTCTATAGCTCGCGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000006283    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_002982.2-161s1c1
Sequence:CCGGCCCAGTCACCTGCTGTTATAACTCGAGTTATAACAGCAGGTGACTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000006282    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 1 Clone ID:NM_002982.2-258s1c1
Sequence:CCGGGCTGTGATCTTCAAGACCATTCTCGAGAATGGTCTTGAAGATCACAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_011333
VALIDATED
CCL2 MISSION shRNA Bacterial Glycerol Stock
chemokine (C-C motif) ligand 2
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000310911    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011333.3-400s21c1
Sequence:CCGGTGCATCTGCCCTAAGGTCTTCCTCGAGGAAGACCTTAGGGCAGATGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000304332    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011333.3-261s21c1
Sequence:CCGGGTCCCAAAGAAGCTGTAGTTTCTCGAGAAACTACAGCTTCTTTGGGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000301702    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011333.3-326s21c1
Sequence:CCGGGAATGGGTCCAGACATACATTCTCGAGAATGTATGTCTGGACCCATTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000301701    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011333.3-204s21c1
Sequence:CCGGGCAAGATGATCCCAATGAGTACTCGAGTACTCATTGGGATCATCTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000304374    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011333.3-539s21c1
Sequence:CCGGTCGGACTGTGATGCCTTAATTCTCGAGAATTAAGGCATCACAGTCCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000034469    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011333.1-362s1c1
Sequence:CCGGCGGAACCAAATGAGATCAGAACTCGAGTTCTGATCTCATTTGGTTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000034470    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011333.1-207s1c1
Sequence:CCGGGCAAGATGATCCCAATGAGTACTCGAGTACTCATTGGGATCATCTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000034471    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011333.1-433s1c1
Sequence:CCGGGAATGTGAAGTTGACCCGTAACTCGAGTTACGGGTCAACTTCACATTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000034472    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011333.1-190s1c1
Sequence:CCGGCTGCTACTCATTCACCAGCAACTCGAGTTGCTGGTGAATGAGTAGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000034473    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011333.1-329s1c1
Sequence:CCGGGAATGGGTCCAGACATACATTCTCGAGAATGTATGTCTGGACCCATTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_011333
VALIDATED
CCL2 MISSION shRNA shRNA Plasmid DNA
chemokine (C-C motif) ligand 2
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000310911    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011333.3-400s21c1
Sequence:CCGGTGCATCTGCCCTAAGGTCTTCCTCGAGGAAGACCTTAGGGCAGATGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000304332    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011333.3-261s21c1
Sequence:CCGGGTCCCAAAGAAGCTGTAGTTTCTCGAGAAACTACAGCTTCTTTGGGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000301702    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011333.3-326s21c1
Sequence:CCGGGAATGGGTCCAGACATACATTCTCGAGAATGTATGTCTGGACCCATTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000301701    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011333.3-204s21c1
Sequence:CCGGGCAAGATGATCCCAATGAGTACTCGAGTACTCATTGGGATCATCTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000304374    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011333.3-539s21c1
Sequence:CCGGTCGGACTGTGATGCCTTAATTCTCGAGAATTAAGGCATCACAGTCCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000034469    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011333.1-362s1c1
Sequence:CCGGCGGAACCAAATGAGATCAGAACTCGAGTTCTGATCTCATTTGGTTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000034470    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011333.1-207s1c1
Sequence:CCGGGCAAGATGATCCCAATGAGTACTCGAGTACTCATTGGGATCATCTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000034471    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011333.1-433s1c1
Sequence:CCGGGAATGTGAAGTTGACCCGTAACTCGAGTTACGGGTCAACTTCACATTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000034472    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011333.1-190s1c1
Sequence:CCGGCTGCTACTCATTCACCAGCAACTCGAGTTGCTGGTGAATGAGTAGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000034473    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011333.1-329s1c1
Sequence:CCGGGAATGGGTCCAGACATACATTCTCGAGAATGTATGTCTGGACCCATTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_011333
VALIDATED
CCL2 MISSION shRNA Lentiviral Transduction Particles
chemokine (C-C motif) ligand 2
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000310911    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011333.3-400s21c1
Sequence:CCGGTGCATCTGCCCTAAGGTCTTCCTCGAGGAAGACCTTAGGGCAGATGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000304332    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011333.3-261s21c1
Sequence:CCGGGTCCCAAAGAAGCTGTAGTTTCTCGAGAAACTACAGCTTCTTTGGGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000301702    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011333.3-326s21c1
Sequence:CCGGGAATGGGTCCAGACATACATTCTCGAGAATGTATGTCTGGACCCATTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000301701    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011333.3-204s21c1
Sequence:CCGGGCAAGATGATCCCAATGAGTACTCGAGTACTCATTGGGATCATCTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000304374    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011333.3-539s21c1
Sequence:CCGGTCGGACTGTGATGCCTTAATTCTCGAGAATTAAGGCATCACAGTCCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000034469    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011333.1-362s1c1
Sequence:CCGGCGGAACCAAATGAGATCAGAACTCGAGTTCTGATCTCATTTGGTTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000034470    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011333.1-207s1c1
Sequence:CCGGGCAAGATGATCCCAATGAGTACTCGAGTACTCATTGGGATCATCTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000034471    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011333.1-433s1c1
Sequence:CCGGGAATGTGAAGTTGACCCGTAACTCGAGTTACGGGTCAACTTCACATTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000034472    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011333.1-190s1c1
Sequence:CCGGCTGCTACTCATTCACCAGCAACTCGAGTTGCTGGTGAATGAGTAGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000034473    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011333.1-329s1c1
Sequence:CCGGGAATGGGTCCAGACATACATTCTCGAGAATGTATGTCTGGACCCATTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks