EMAIL THIS PAGE TO A FRIEND

CCL3

chemokine (C-C motif) ligand 3

Synonyms: G0S19-1 LD78ALPHA MIP-1-alpha MIP1A SCYA3
UniProtKB ID: P10147
Gene ID:
Human(6348) Summary: This locus represents a small inducible cytokine. The encoded protein, also known as macrophage inflammatory protein 1 alpha, plays a role in inflammatory responses through binding to the receptors CCR1, CCR4 and CCR5. Polymorphisms at this locus may be associated with both resistance and susceptibility to infection by human immunodeficiency virus type 1.[provided by RefSeq, Sep 2010]
Mouse(20302) chemokine (C-C motif) ligand 3
Rat(25542) chemokine (C-C motif) ligand 3
dog(448787) chemokine (C-C motif) ligand 3
cow(282170) chemokine (C-C motif) ligand 3
Horse(100057909) chemokine (C-C motif) ligand 3
87 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_011337 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_011337 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_011337 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_002983 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_002983 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_002983 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU115051 MISSION® esiRNA esiRNA human CCL3 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_002983 Rosetta Predictions human pricing
NM_013025 Rosetta Predictions rat pricing
NM_011337 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_002983 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00079749 predicted 292
2 SASI_Hs01_00079750 predicted 285
3 SASI_Hs01_00079751 predicted 636
4 SASI_Hs01_00079752 predicted 154
5 SASI_Hs01_00079753 predicted 155
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_013025 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00098798 predicted 267
2 SASI_Rn01_00098799 predicted 232
3 SASI_Rn01_00098801 predicted 237
4 SASI_Rn01_00098802 predicted 708
5 SASI_Rn01_00098804 predicted 326
6 SASI_Rn01_00098805 predicted 637
7 SASI_Rn02_00260706 predicted 559
8 SASI_Rn01_00098806 predicted 330
9 SASI_Rn01_00098807 predicted 559
10 SASI_Rn02_00260707 predicted 328
11 SASI_Rn01_00098800 predicted 235
12 SASI_Rn01_00098803 predicted 639
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_011337 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00144836 predicted 224
2 SASI_Mm02_00320459 predicted 505
3 SASI_Mm02_00320460 predicted 546
4 SASI_Mm01_00144837 predicted 222
5 SASI_Mm02_00320461 predicted 362
6 SASI_Mm01_00144840 predicted 310
7 SASI_Mm01_00144842 predicted 260
8 SASI_Mm02_00320462 predicted 323
9 SASI_Mm02_00320463 predicted 209
10 SASI_Mm02_00320464 predicted 359
11 SASI_Mm01_00144838 predicted 214
12 SASI_Mm01_00144839 predicted 213
13 SASI_Mm01_00144841 predicted 289
14 SASI_Mm01_00144843 predicted 286
15 SASI_Mm01_00144844 predicted 239
16 SASI_Mm01_00144845 predicted 288
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_011337
CCL3 MISSION shRNA Bacterial Glycerol Stock
chemokine (C-C motif) ligand 3
Mouse
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000450323    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011337.2-135s21c1
Sequence:CCGGCTCTGTACCATGACACTCTGCCTCGAGGCAGAGTGTCATGGTACAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000068003    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011337.1-210s1c1
Sequence:CCGGCGCCAATTCATCGTTGACTATCTCGAGATAGTCAACGATGAATTGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000068004    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011337.1-196s1c1
Sequence:CCGGGCCGGAAGATTCCACGCCAATCTCGAGATTGGCGTGGAATCTTCCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000068005    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011337.1-275s1c1
Sequence:CCGGGACTAAGAGAAACCGGCAGATCTCGAGATCTGCCGGTTTCTCTTAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000068006    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011337.1-138s1c1
Sequence:CCGGCAAGTCTTCTCAGCGCCATATCTCGAGATATGGCGCTGAGAAGACTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000068007    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011337.1-327s1c1
Sequence:CCGGGAATACATCACTGACCTGGAACTCGAGTTCCAGGTCAGTGATGTATTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_011337
CCL3 MISSION shRNA shRNA Plasmid DNA
chemokine (C-C motif) ligand 3
Mouse
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000450323    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011337.2-135s21c1
Sequence:CCGGCTCTGTACCATGACACTCTGCCTCGAGGCAGAGTGTCATGGTACAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000068003    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011337.1-210s1c1
Sequence:CCGGCGCCAATTCATCGTTGACTATCTCGAGATAGTCAACGATGAATTGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000068004    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011337.1-196s1c1
Sequence:CCGGGCCGGAAGATTCCACGCCAATCTCGAGATTGGCGTGGAATCTTCCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000068005    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011337.1-275s1c1
Sequence:CCGGGACTAAGAGAAACCGGCAGATCTCGAGATCTGCCGGTTTCTCTTAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000068006    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011337.1-138s1c1
Sequence:CCGGCAAGTCTTCTCAGCGCCATATCTCGAGATATGGCGCTGAGAAGACTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000068007    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011337.1-327s1c1
Sequence:CCGGGAATACATCACTGACCTGGAACTCGAGTTCCAGGTCAGTGATGTATTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_011337
CCL3 MISSION shRNA Lentiviral Transduction Particles
chemokine (C-C motif) ligand 3
Mouse
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000450323    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011337.2-135s21c1
Sequence:CCGGCTCTGTACCATGACACTCTGCCTCGAGGCAGAGTGTCATGGTACAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000068003    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011337.1-210s1c1
Sequence:CCGGCGCCAATTCATCGTTGACTATCTCGAGATAGTCAACGATGAATTGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000068004    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011337.1-196s1c1
Sequence:CCGGGCCGGAAGATTCCACGCCAATCTCGAGATTGGCGTGGAATCTTCCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000068005    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011337.1-275s1c1
Sequence:CCGGGACTAAGAGAAACCGGCAGATCTCGAGATCTGCCGGTTTCTCTTAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000068006    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011337.1-138s1c1
Sequence:CCGGCAAGTCTTCTCAGCGCCATATCTCGAGATATGGCGCTGAGAAGACTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000068007    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011337.1-327s1c1
Sequence:CCGGGAATACATCACTGACCTGGAACTCGAGTTCCAGGTCAGTGATGTATTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_002983
CCL3 MISSION shRNA Bacterial Glycerol Stock
chemokine (C-C motif) ligand 3
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000371687    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002983.2-469s21c1
Sequence:CCGGTCCACAGCTACCTCTTCTATGCTCGAGCATAGAAGAGGTAGCTGTGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000371623    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002983.2-578s21c1
Sequence:CCGGTTCGATTTCACAGTGTGTTTGCTCGAGCAAACACACTGTGAAATCGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000057928    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_002983.1-498s1c1
Sequence:CCGGGTGGGACTCTTCTTAACTTAACTCGAGTTAAGTTAAGAAGAGTCCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000057929    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002983.1-200s1c1
Sequence:CCGGCCGGCAGATTCCACAGAATTTCTCGAGAAATTCTGTGGAATCTGCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000057930    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002983.1-263s1c1
Sequence:CCGGCGGTGTCATCTTCCTAACCAACTCGAGTTGGTTAGGAAGATGACACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000057932    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002983.1-329s1c1
Sequence:CCGGGAAATATGTCAGCGACCTAGACTCGAGTCTAGGTCGCTGACATATTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000057931    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002983.1-137s1c1
Sequence:CCGGCAACCAGTTCTCTGCATCACTCTCGAGAGTGATGCAGAGAACTGGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_002983
CCL3 MISSION shRNA shRNA Plasmid DNA
chemokine (C-C motif) ligand 3
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000371687    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002983.2-469s21c1
Sequence:CCGGTCCACAGCTACCTCTTCTATGCTCGAGCATAGAAGAGGTAGCTGTGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000371623    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002983.2-578s21c1
Sequence:CCGGTTCGATTTCACAGTGTGTTTGCTCGAGCAAACACACTGTGAAATCGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000057928    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_002983.1-498s1c1
Sequence:CCGGGTGGGACTCTTCTTAACTTAACTCGAGTTAAGTTAAGAAGAGTCCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000057929    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002983.1-200s1c1
Sequence:CCGGCCGGCAGATTCCACAGAATTTCTCGAGAAATTCTGTGGAATCTGCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000057930    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002983.1-263s1c1
Sequence:CCGGCGGTGTCATCTTCCTAACCAACTCGAGTTGGTTAGGAAGATGACACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000057932    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002983.1-329s1c1
Sequence:CCGGGAAATATGTCAGCGACCTAGACTCGAGTCTAGGTCGCTGACATATTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000057931    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002983.1-137s1c1
Sequence:CCGGCAACCAGTTCTCTGCATCACTCTCGAGAGTGATGCAGAGAACTGGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_002983
CCL3 MISSION shRNA Lentiviral Transduction Particles
chemokine (C-C motif) ligand 3
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000371687    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002983.2-469s21c1
Sequence:CCGGTCCACAGCTACCTCTTCTATGCTCGAGCATAGAAGAGGTAGCTGTGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000371623    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002983.2-578s21c1
Sequence:CCGGTTCGATTTCACAGTGTGTTTGCTCGAGCAAACACACTGTGAAATCGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000057928    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_002983.1-498s1c1
Sequence:CCGGGTGGGACTCTTCTTAACTTAACTCGAGTTAAGTTAAGAAGAGTCCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000057929    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002983.1-200s1c1
Sequence:CCGGCCGGCAGATTCCACAGAATTTCTCGAGAAATTCTGTGGAATCTGCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000057930    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002983.1-263s1c1
Sequence:CCGGCGGTGTCATCTTCCTAACCAACTCGAGTTGGTTAGGAAGATGACACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000057932    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002983.1-329s1c1
Sequence:CCGGGAAATATGTCAGCGACCTAGACTCGAGTCTAGGTCGCTGACATATTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000057931    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002983.1-137s1c1
Sequence:CCGGCAACCAGTTCTCTGCATCACTCTCGAGAGTGATGCAGAGAACTGGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks