EMAIL THIS PAGE TO A FRIEND

CCL3L1

chemokine (C-C motif) ligand 3-like 1

7 Gene Product Result for
Synonyms: 464.2 D17S1718 G0S19-2 LD78 LD78BETA MIP1AP SCYA3L SCYA3L1
Species: Human CCL3L1(6349)
UniProtKB ID: P16619, A6NGK6, B2RUX4, Q3B7A8, Q53YA5, Q96I68
Gene ID:
Human(6349) Summary: This gene is one of several cytokine genes clustered on the q-arm of chromosome 17. Cytokines are a family of secreted proteins involved in immunoregulatory and inflammatory processes. This protein binds to several chemokine receptors including chemokine binding protein 2 and chemokine (C-C motif) receptor 5 (CCR5). CCR5 is a co-receptor for HIV, and binding of this protein to CCR5 inhibits HIV entry. The copy number of this gene varies among individuals; most individuals have 1-6 copies in the diploid genome, although rare individuals have zero or more than six copies. The human genome reference assembly contains two full copies of the gene (CCL3L3 and CCL3L1) and a partial pseudogene. This record represents the more telomeric full-length gene. [provided by RefSeq, Apr 2010]
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_021006 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_021006 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_021006 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_021006 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_021006 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00245061 predicted 748
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_021006
CCL3L1 MISSION shRNA Bacterial Glycerol Stock
chemokine (C-C motif) ligand 3-like 1
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000058043    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_021006.4-464s1c1
Sequence:CCGGCCTCTTCTATGGACTGGTTATCTCGAGATAACCAGTCCATAGAAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000058044    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021006.4-203s1c1
Sequence:CCGGCCCGACAGATTCCACAGAATTCTCGAGAATTCTGTGGAATCTGTCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000058045    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021006.4-267s1c1
Sequence:CCGGCAGTGTCATCTTCCTAACCAACTCGAGTTGGTTAGGAAGATGACACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000058047    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021006.4-330s1c1
Sequence:CCGGCCAGAAATACGTCAGTGACCTCTCGAGAGGTCACTGACGTATTTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000058046    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021006.4-216s1c1
Sequence:CCGGACAGAATTTCATAGCTGACTACTCGAGTAGTCAGCTATGAAATTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000371688    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021006.4-573s21c1
Sequence:CCGGCAGTGTGTTTGTGATTGTTTGCTCGAGCAAACAATCACAAACACACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000371625    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021006.4-503s21c1
Sequence:CCGGTGGGACTCTTCTTAACTTAAACTCGAGTTTAAGTTAAGAAGAGTCCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_021006
CCL3L1 MISSION shRNA shRNA Plasmid DNA
chemokine (C-C motif) ligand 3-like 1
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000058043    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_021006.4-464s1c1
Sequence:CCGGCCTCTTCTATGGACTGGTTATCTCGAGATAACCAGTCCATAGAAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000058044    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021006.4-203s1c1
Sequence:CCGGCCCGACAGATTCCACAGAATTCTCGAGAATTCTGTGGAATCTGTCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000058045    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021006.4-267s1c1
Sequence:CCGGCAGTGTCATCTTCCTAACCAACTCGAGTTGGTTAGGAAGATGACACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000058047    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021006.4-330s1c1
Sequence:CCGGCCAGAAATACGTCAGTGACCTCTCGAGAGGTCACTGACGTATTTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000058046    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021006.4-216s1c1
Sequence:CCGGACAGAATTTCATAGCTGACTACTCGAGTAGTCAGCTATGAAATTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000371688    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021006.4-573s21c1
Sequence:CCGGCAGTGTGTTTGTGATTGTTTGCTCGAGCAAACAATCACAAACACACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000371625    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021006.4-503s21c1
Sequence:CCGGTGGGACTCTTCTTAACTTAAACTCGAGTTTAAGTTAAGAAGAGTCCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_021006
CCL3L1 MISSION shRNA Lentiviral Transduction Particles
chemokine (C-C motif) ligand 3-like 1
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000058043    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_021006.4-464s1c1
Sequence:CCGGCCTCTTCTATGGACTGGTTATCTCGAGATAACCAGTCCATAGAAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000058044    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021006.4-203s1c1
Sequence:CCGGCCCGACAGATTCCACAGAATTCTCGAGAATTCTGTGGAATCTGTCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000058045    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021006.4-267s1c1
Sequence:CCGGCAGTGTCATCTTCCTAACCAACTCGAGTTGGTTAGGAAGATGACACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000058047    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021006.4-330s1c1
Sequence:CCGGCCAGAAATACGTCAGTGACCTCTCGAGAGGTCACTGACGTATTTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000058046    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021006.4-216s1c1
Sequence:CCGGACAGAATTTCATAGCTGACTACTCGAGTAGTCAGCTATGAAATTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000371688    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021006.4-573s21c1
Sequence:CCGGCAGTGTGTTTGTGATTGTTTGCTCGAGCAAACAATCACAAACACACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000371625    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021006.4-503s21c1
Sequence:CCGGTGGGACTCTTCTTAACTTAAACTCGAGTTTAAGTTAAGAAGAGTCCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks