EMAIL THIS PAGE TO A FRIEND

CCL4

chemokine (C-C motif) ligand 4

106 Gene Product Result for
Synonyms: ACT2 AT744.1 G-26 HC21 LAG-1 LAG1 MIP-1-beta MIP1B MIP1B1 SCYA2 SCYA4
UniProtKB ID: P13236, P22617, Q13704, Q3SXL8, Q6FGI8
Gene ID:
Human(6351) Summary: The protein encoded by this gene is a mitogen-inducible monokine and is one of the major HIV-suppressive factors produced by CD8+ T-cells. The encoded protein is secreted and has chemokinetic and inflammatory functions. [provided by RefSeq, Dec 2012]
Mouse(20303) chemokine (C-C motif) ligand 4
Rat(116637) chemokine (C-C motif) ligand 4
chicken(395551) chemokine (C-C motif) ligand 4
cow(414347) chemokine (C-C motif) ligand 4
dog(448786) chemokine (C-C motif) ligand 4
chicken(395468) chemokine (C-C motif) ligand 4
domestic guinea pig(100735368) chemokine (C-C motif) ligand 4
sheep(101114285) chemokine (C-C motif) ligand 4
Domestic Rabbit(100008984) chemokine (C-C motif) ligand 4
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_013652 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_013652 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_013652 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_002984 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_002984 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_002984 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU116731 MISSION® esiRNA esiRNA human CCL4 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_002984 Rosetta Predictions human pricing
NM_053858 Rosetta Predictions rat pricing
NM_013652 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_002984 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00061811 predicted 290
2 SASI_Hs01_00061812 predicted 292
3 SASI_Hs01_00061813 predicted 404
4 SASI_Hs01_00061814 predicted 414
5 SASI_Hs01_00061816 predicted 571
6 SASI_Hs01_00061817 predicted 493
7 SASI_Hs01_00061818 predicted 453
8 SASI_Hs01_00061819 predicted 483
9 SASI_Hs01_00061815 predicted 608
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_053858 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00030988 predicted 175
2 SASI_Rn02_00266723 predicted 44
3 SASI_Rn01_00030989 predicted 229
4 SASI_Rn01_00030990 predicted 114
5 SASI_Rn01_00030991 predicted 129
6 SASI_Rn01_00030992 predicted 118
7 SASI_Rn01_00030993 predicted 110
8 SASI_Rn01_00030995 predicted 123
9 SASI_Rn01_00030996 predicted 229
10 SASI_Rn01_00030997 predicted 9
11 SASI_Rn01_00030994 predicted 186
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_013652 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00080361 predicted 260
2 SASI_Mm01_00080362 predicted 214
3 SASI_Mm01_00080363 predicted 255
4 SASI_Mm02_00322472 predicted 191
5 SASI_Mm01_00080364 predicted 255
6 SASI_Mm02_00322473 predicted 253
7 SASI_Mm02_00322474 predicted 195
8 SASI_Mm01_00080365 predicted 211
9 SASI_Mm01_00080366 predicted 202
10 SASI_Mm01_00080367 predicted 252
11 SASI_Mm01_00080368 predicted 237
12 SASI_Mm01_00080369 predicted 214
13 SASI_Mm01_00080370 predicted 163
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_013652
CCL4 MISSION shRNA Bacterial Glycerol Stock
chemokine (C-C motif) ligand 4
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000068048    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_013652.1-408s1c1
Sequence:CCGGCCTGATGCTTCTCACTGAGAACTCGAGTTCTCAGTGAGAAGCATCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000068052    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013652.1-170s1c1
Sequence:CCGGCACTTCCTGCTGTTTCTCTTACTCGAGTAAGAGAAACAGCAGGAAGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000068051    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013652.1-323s1c1
Sequence:CCGGCACTGAGTACATGAGTGACTTCTCGAGAAGTCACTCATGTACTCAGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000068049    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013652.1-261s1c1
Sequence:CCGGGCTGTGGTATTCCTGACCAAACTCGAGTTTGGTCAGGAATACCACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000068050    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013652.1-203s1c1
Sequence:CCGGGCTTCACAGAAGCTTTGTGATCTCGAGATCACAAAGCTTCTGTGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000441627    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013652.2-232s21c1
Sequence:CCGGCTATGAGACCAGCAGTCTTTGCTCGAGCAAAGACTGCTGGTCTCATAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000425182    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013652.2-347s21c1
Sequence:CCGGGAGTTGAACTGAGCAGCTCCACTCGAGTGGAGCTGCTCAGTTCAACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000435597    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_013652.2-551s21c1
Sequence:CCGGACGCGTGTCTCCCATGGAGATCTCGAGATCTCCATGGGAGACACGCGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_013652
CCL4 MISSION shRNA shRNA Plasmid DNA
chemokine (C-C motif) ligand 4
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000068048    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_013652.1-408s1c1
Sequence:CCGGCCTGATGCTTCTCACTGAGAACTCGAGTTCTCAGTGAGAAGCATCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000068052    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013652.1-170s1c1
Sequence:CCGGCACTTCCTGCTGTTTCTCTTACTCGAGTAAGAGAAACAGCAGGAAGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000068051    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013652.1-323s1c1
Sequence:CCGGCACTGAGTACATGAGTGACTTCTCGAGAAGTCACTCATGTACTCAGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000068049    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013652.1-261s1c1
Sequence:CCGGGCTGTGGTATTCCTGACCAAACTCGAGTTTGGTCAGGAATACCACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000068050    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013652.1-203s1c1
Sequence:CCGGGCTTCACAGAAGCTTTGTGATCTCGAGATCACAAAGCTTCTGTGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000441627    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013652.2-232s21c1
Sequence:CCGGCTATGAGACCAGCAGTCTTTGCTCGAGCAAAGACTGCTGGTCTCATAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000425182    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013652.2-347s21c1
Sequence:CCGGGAGTTGAACTGAGCAGCTCCACTCGAGTGGAGCTGCTCAGTTCAACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000435597    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_013652.2-551s21c1
Sequence:CCGGACGCGTGTCTCCCATGGAGATCTCGAGATCTCCATGGGAGACACGCGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_013652
CCL4 MISSION shRNA Lentiviral Transduction Particles
chemokine (C-C motif) ligand 4
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000068048    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_013652.1-408s1c1
Sequence:CCGGCCTGATGCTTCTCACTGAGAACTCGAGTTCTCAGTGAGAAGCATCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000068052    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013652.1-170s1c1
Sequence:CCGGCACTTCCTGCTGTTTCTCTTACTCGAGTAAGAGAAACAGCAGGAAGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000068051    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013652.1-323s1c1
Sequence:CCGGCACTGAGTACATGAGTGACTTCTCGAGAAGTCACTCATGTACTCAGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000068049    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013652.1-261s1c1
Sequence:CCGGGCTGTGGTATTCCTGACCAAACTCGAGTTTGGTCAGGAATACCACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000068050    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013652.1-203s1c1
Sequence:CCGGGCTTCACAGAAGCTTTGTGATCTCGAGATCACAAAGCTTCTGTGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000441627    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013652.2-232s21c1
Sequence:CCGGCTATGAGACCAGCAGTCTTTGCTCGAGCAAAGACTGCTGGTCTCATAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000425182    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013652.2-347s21c1
Sequence:CCGGGAGTTGAACTGAGCAGCTCCACTCGAGTGGAGCTGCTCAGTTCAACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000435597    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_013652.2-551s21c1
Sequence:CCGGACGCGTGTCTCCCATGGAGATCTCGAGATCTCCATGGGAGACACGCGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_002984
CCL4 MISSION shRNA Bacterial Glycerol Stock
chemokine (C-C motif) ligand 4
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000057982    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002984.1-363s1c1
Sequence:CCGGCGTGTATGACCTGGAACTGAACTCGAGTTCAGTTCCAGGTCATACACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000057978    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002984.1-329s1c1
Sequence:CCGGGTGCTGATCCCAGTGAATCCTCTCGAGAGGATTCACTGGGATCAGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000057980    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002984.1-138s1c1
Sequence:CCGGCCTCATGCTAGTAGCTGCCTTCTCGAGAAGGCAGCTACTAGCATGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000057981    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002984.1-239s1c1
Sequence:CCGGCTCGCAACTTTGTGGTAGATTCTCGAGAATCTACCACAAAGTTGCGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000057979    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002984.1-316s1c1
Sequence:CCGGAGCAAGCAAGTCTGTGCTGATCTCGAGATCAGCACAGACTTGCTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000359427    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002984.2-211s21c1
Sequence:CCGGTCGCAACTTTGTGGTAGATTACTCGAGTAATCTACCACAAAGTTGCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000359507    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002984.2-457s21c1
Sequence:CCGGTCCTGTCCCTTCTCTTAATTTCTCGAGAAATTAAGAGAAGGGACAGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000359506    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002984.2-488s21c1
Sequence:CCGGATGTGCCGTGTTATTGTATTACTCGAGTAATACAATAACACGGCACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000359505    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002984.2-298s21c1
Sequence:CCGGCTGTGCTGATCCCAGTGAATCCTCGAGGATTCACTGGGATCAGCACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_002984
CCL4 MISSION shRNA shRNA Plasmid DNA
chemokine (C-C motif) ligand 4
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000057982    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002984.1-363s1c1
Sequence:CCGGCGTGTATGACCTGGAACTGAACTCGAGTTCAGTTCCAGGTCATACACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000057978    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002984.1-329s1c1
Sequence:CCGGGTGCTGATCCCAGTGAATCCTCTCGAGAGGATTCACTGGGATCAGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000057980    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002984.1-138s1c1
Sequence:CCGGCCTCATGCTAGTAGCTGCCTTCTCGAGAAGGCAGCTACTAGCATGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000057981    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002984.1-239s1c1
Sequence:CCGGCTCGCAACTTTGTGGTAGATTCTCGAGAATCTACCACAAAGTTGCGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000057979    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002984.1-316s1c1
Sequence:CCGGAGCAAGCAAGTCTGTGCTGATCTCGAGATCAGCACAGACTTGCTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000359427    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002984.2-211s21c1
Sequence:CCGGTCGCAACTTTGTGGTAGATTACTCGAGTAATCTACCACAAAGTTGCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000359507    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002984.2-457s21c1
Sequence:CCGGTCCTGTCCCTTCTCTTAATTTCTCGAGAAATTAAGAGAAGGGACAGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000359506    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002984.2-488s21c1
Sequence:CCGGATGTGCCGTGTTATTGTATTACTCGAGTAATACAATAACACGGCACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000359505    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002984.2-298s21c1
Sequence:CCGGCTGTGCTGATCCCAGTGAATCCTCGAGGATTCACTGGGATCAGCACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_002984
CCL4 MISSION shRNA Lentiviral Transduction Particles
chemokine (C-C motif) ligand 4
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000057982    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002984.1-363s1c1
Sequence:CCGGCGTGTATGACCTGGAACTGAACTCGAGTTCAGTTCCAGGTCATACACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000057978    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002984.1-329s1c1
Sequence:CCGGGTGCTGATCCCAGTGAATCCTCTCGAGAGGATTCACTGGGATCAGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000057980    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002984.1-138s1c1
Sequence:CCGGCCTCATGCTAGTAGCTGCCTTCTCGAGAAGGCAGCTACTAGCATGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000057981    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002984.1-239s1c1
Sequence:CCGGCTCGCAACTTTGTGGTAGATTCTCGAGAATCTACCACAAAGTTGCGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000057979    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002984.1-316s1c1
Sequence:CCGGAGCAAGCAAGTCTGTGCTGATCTCGAGATCAGCACAGACTTGCTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000359427    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002984.2-211s21c1
Sequence:CCGGTCGCAACTTTGTGGTAGATTACTCGAGTAATCTACCACAAAGTTGCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000359507    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002984.2-457s21c1
Sequence:CCGGTCCTGTCCCTTCTCTTAATTTCTCGAGAAATTAAGAGAAGGGACAGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000359506    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002984.2-488s21c1
Sequence:CCGGATGTGCCGTGTTATTGTATTACTCGAGTAATACAATAACACGGCACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000359505    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002984.2-298s21c1
Sequence:CCGGCTGTGCTGATCCCAGTGAATCCTCGAGGATTCACTGGGATCAGCACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks