EMAIL THIS PAGE TO A FRIEND

CCL4L1

chemokine (C-C motif) ligand 4-like 1

Synonyms: AT744.2 CCL4L LAG-1 LAG1 SCYA4L
Species: Human CCL4L1(9560)
Gene ID:
Human(9560) Summary: This gene is one of several cytokine genes clustered on the q-arm of chromosome 17. Cytokines are a family of secreted proteins involved in immunoregulatory and inflammatory processes. This protein is similar to CCL4 which inhibits HIV entry by binding to the cellular receptor CCR5. The copy number of this gene varies among individuals; most individuals have 1-5 copies in the diploid genome, although rare individuals do not contain this gene at all. The human genome reference assembly contains two copies of this gene. This record represents the more centromeric gene. [provided by RefSeq, Jul 2008]
10 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB1301209 ANTI-CCL4L1 (CENTER) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
flow cytometry, immunohistochemistry, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001001435 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001001435 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001001435 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001001435 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001001435 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00010231 predicted 409
2 SASI_Hs01_00010232 predicted 451
3 SASI_Hs01_00010234 predicted 448
4 SASI_Hs01_00010235 predicted 122
5 SASI_Hs01_00010236 predicted 486
6 SASI_Hs01_00010233 predicted 563
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001001435
CCL4L1 MISSION shRNA Bacterial Glycerol Stock
chemokine (C-C motif) ligand 4-like 1
Human
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000057888    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001001435.2-449s1c1
Sequence:CCGGGCAGTTCCTGTCTCTTCTCTTCTCGAGAAGAGAAGAGACAGGAACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000057889    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001435.2-260s1c1
Sequence:CCGGGCTGTGGTATTCCAAACCAAACTCGAGTTTGGTTTGGAATACCACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000057890    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001435.2-206s1c1
Sequence:CCGGCCTCGCAACTTTGTGGTAGATCTCGAGATCTACCACAAAGTTGCGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000057892    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001435.2-133s1c1
Sequence:CCGGTCTAGCACTCTCAGCACCAATCTCGAGATTGGTGCTGAGAGTGCTAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001001435
CCL4L1 MISSION shRNA shRNA Plasmid DNA
chemokine (C-C motif) ligand 4-like 1
Human
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000057888    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001001435.2-449s1c1
Sequence:CCGGGCAGTTCCTGTCTCTTCTCTTCTCGAGAAGAGAAGAGACAGGAACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000057889    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001435.2-260s1c1
Sequence:CCGGGCTGTGGTATTCCAAACCAAACTCGAGTTTGGTTTGGAATACCACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000057890    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001435.2-206s1c1
Sequence:CCGGCCTCGCAACTTTGTGGTAGATCTCGAGATCTACCACAAAGTTGCGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000057892    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001435.2-133s1c1
Sequence:CCGGTCTAGCACTCTCAGCACCAATCTCGAGATTGGTGCTGAGAGTGCTAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001001435
CCL4L1 MISSION shRNA Lentiviral Transduction Particles
chemokine (C-C motif) ligand 4-like 1
Human
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000057888    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001001435.2-449s1c1
Sequence:CCGGGCAGTTCCTGTCTCTTCTCTTCTCGAGAAGAGAAGAGACAGGAACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000057889    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001435.2-260s1c1
Sequence:CCGGGCTGTGGTATTCCAAACCAAACTCGAGTTTGGTTTGGAATACCACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000057890    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001435.2-206s1c1
Sequence:CCGGCCTCGCAACTTTGTGGTAGATCTCGAGATCTACCACAAAGTTGCGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000057892    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001435.2-133s1c1
Sequence:CCGGTCTAGCACTCTCAGCACCAATCTCGAGATTGGTGCTGAGAGTGCTAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks