EMAIL THIS PAGE TO A FRIEND

CCL4L2

chemokine (C-C motif) ligand 4-like 2

77 Gene Product Result for
Synonyms: AT744.2 CCL4L SCYA4L
Species: Human CCL4L2(388372)
Gene ID:
Human(388372) Summary: This gene is one of several cytokine genes clustered on the q-arm of chromosome 17. Cytokines are a family of secreted proteins involved in immunoregulatory and inflammatory processes. This protein is similar to CCL4 which inhibits HIV entry by binding to the cellular receptor CCR5. The copy number of this gene varies among individuals; most individuals have 1-5 copies in the diploid genome, although rare individuals do not contain this gene at all. The human genome reference assembly contains two copies of this gene. This record represents the more telomeric gene. [provided by RefSeq, Jul 2008]
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
WH0388372M1 Monoclonal Anti-CCL4L2 antibody produced in mouse clone 4G8, purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_207007 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_207007 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_207007 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU159861 MISSION® esiRNA esiRNA human CCL4L2 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_207007 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_207007 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00094714 predicted 409
2 SASI_Hs01_00094715 predicted 454
3 SASI_Hs01_00094717 predicted 456
4 SASI_Hs01_00094718 predicted 116
5 SASI_Hs01_00094719 predicted 605
6 SASI_Hs01_00094720 predicted 485
7 SASI_Hs01_00094716 predicted 569
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_207007
CCL4L2 MISSION shRNA Bacterial Glycerol Stock
chemokine (C-C motif) ligand 4-like 2
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000158046    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207007.2-206s1c1
Sequence:CCGGCCTCGCAACTTTGTGGTAGATCTCGAGATCTACCACAAAGTTGCGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000157561    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207007.2-326s1c1
Sequence:CCGGGAGTACGTGTATGACCTGGAACTCGAGTTCCAGGTCATACACGTACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000156886    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207007.2-328s1c1
Sequence:CCGGGTACGTGTATGACCTGGAACTCTCGAGAGTTCCAGGTCATACACGTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000157235    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_207007.2-449s1c1
Sequence:CCGGGCAGTTCCTGTCTCTTCTCTTCTCGAGAAGAGAAGAGACAGGAACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000156368    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207007.2-331s1c1
Sequence:CCGGCGTGTATGACCTGGAACTGAACTCGAGTTCAGTTCCAGGTCATACACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000154192    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207007.2-209s1c1
Sequence:CCGGCGCAACTTTGTGGTAGATTACCTCGAGGTAATCTACCACAAAGTTGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000153756    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_207007.2-450s1c1
Sequence:CCGGCAGTTCCTGTCTCTTCTCTTACTCGAGTAAGAGAAGAGACAGGAACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000153252    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207007.2-260s1c1
Sequence:CCGGGCTGTGGTATTCCAAACCAAACTCGAGTTTGGTTTGGAATACCACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000153531    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207007.2-207s1c1
Sequence:CCGGCTCGCAACTTTGTGGTAGATTCTCGAGAATCTACCACAAAGTTGCGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000151683    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207007.2-210s1c1
Sequence:CCGGGCAACTTTGTGGTAGATTACTCTCGAGAGTAATCTACCACAAAGTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_207007
CCL4L2 MISSION shRNA shRNA Plasmid DNA
chemokine (C-C motif) ligand 4-like 2
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000158046    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207007.2-206s1c1
Sequence:CCGGCCTCGCAACTTTGTGGTAGATCTCGAGATCTACCACAAAGTTGCGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000157561    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207007.2-326s1c1
Sequence:CCGGGAGTACGTGTATGACCTGGAACTCGAGTTCCAGGTCATACACGTACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000156886    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207007.2-328s1c1
Sequence:CCGGGTACGTGTATGACCTGGAACTCTCGAGAGTTCCAGGTCATACACGTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000157235    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_207007.2-449s1c1
Sequence:CCGGGCAGTTCCTGTCTCTTCTCTTCTCGAGAAGAGAAGAGACAGGAACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000156368    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207007.2-331s1c1
Sequence:CCGGCGTGTATGACCTGGAACTGAACTCGAGTTCAGTTCCAGGTCATACACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000154192    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207007.2-209s1c1
Sequence:CCGGCGCAACTTTGTGGTAGATTACCTCGAGGTAATCTACCACAAAGTTGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000153756    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_207007.2-450s1c1
Sequence:CCGGCAGTTCCTGTCTCTTCTCTTACTCGAGTAAGAGAAGAGACAGGAACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000153252    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207007.2-260s1c1
Sequence:CCGGGCTGTGGTATTCCAAACCAAACTCGAGTTTGGTTTGGAATACCACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000153531    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207007.2-207s1c1
Sequence:CCGGCTCGCAACTTTGTGGTAGATTCTCGAGAATCTACCACAAAGTTGCGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000151683    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207007.2-210s1c1
Sequence:CCGGGCAACTTTGTGGTAGATTACTCTCGAGAGTAATCTACCACAAAGTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_207007
CCL4L2 MISSION shRNA Lentiviral Transduction Particles
chemokine (C-C motif) ligand 4-like 2
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000158046    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207007.2-206s1c1
Sequence:CCGGCCTCGCAACTTTGTGGTAGATCTCGAGATCTACCACAAAGTTGCGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000157561    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207007.2-326s1c1
Sequence:CCGGGAGTACGTGTATGACCTGGAACTCGAGTTCCAGGTCATACACGTACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000156886    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207007.2-328s1c1
Sequence:CCGGGTACGTGTATGACCTGGAACTCTCGAGAGTTCCAGGTCATACACGTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000157235    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_207007.2-449s1c1
Sequence:CCGGGCAGTTCCTGTCTCTTCTCTTCTCGAGAAGAGAAGAGACAGGAACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000156368    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207007.2-331s1c1
Sequence:CCGGCGTGTATGACCTGGAACTGAACTCGAGTTCAGTTCCAGGTCATACACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000154192    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207007.2-209s1c1
Sequence:CCGGCGCAACTTTGTGGTAGATTACCTCGAGGTAATCTACCACAAAGTTGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000153756    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_207007.2-450s1c1
Sequence:CCGGCAGTTCCTGTCTCTTCTCTTACTCGAGTAAGAGAAGAGACAGGAACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000153252    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207007.2-260s1c1
Sequence:CCGGGCTGTGGTATTCCAAACCAAACTCGAGTTTGGTTTGGAATACCACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000153531    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_207007.2-207s1c1
Sequence:CCGGCTCGCAACTTTGTGGTAGATTCTCGAGAATCTACCACAAAGTTGCGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000151683    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207007.2-210s1c1
Sequence:CCGGGCAACTTTGTGGTAGATTACTCTCGAGAGTAATCTACCACAAAGTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks