EMAIL THIS PAGE TO A FRIEND

CCL5

chemokine (C-C motif) ligand 5

81 Gene Product Result for
Synonyms: D17S136E RANTES SCYA5 SIS-delta SISd TCP228 eoCP
Gene ID:
Human(6352) Summary: This gene is one of several chemokine genes clustered on the q-arm of chromosome 17. Chemokines form a superfamily of secreted proteins involved in immunoregulatory and inflammatory processes. The superfamily is divided into four subfamilies based on the arrangement of two N-terminal cysteine residues of the mature peptide. This chemokine, a member of the CC subfamily, functions as a chemoattractant for blood monocytes, memory T helper cells and eosinophils. It causes the release of histamine from basophils and activates eosinophils. This cytokine is one of the major HIV-suppressive factors produced by CD8+ cells. It functions as one of the natural ligands for the chemokine receptor chemokine (C-C motif) receptor 5 (CCR5), and it suppresses in vitro replication of the R5 strains of HIV-1, which use CCR5 as a coreceptor. Alternative splicing results in multiple transcript variants that encode different isoforms. [provided by RefSeq, Jul 2013]
Mouse(20304) chemokine (C-C motif) ligand 5
Rat(81780) chemokine (C-C motif) ligand 5
chicken(417465) chemokine (C-C motif) ligand 5
dog(403522) chemokine (C-C motif) ligand 5
cow(327712) chemokine (C-C motif) ligand 5
Horse(100033925) chemokine (C-C motif) ligand 5
domestic cat(493689) chemokine (C-C motif) ligand 5
sheep(101115553) chemokine (C-C motif) ligand 5
domestic guinea pig(100135495) chemokine (C-C motif) ligand 5
naked mole-rat(101712384) chemokine (C-C motif) ligand 5
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_013653 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_013653 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_013653 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_002985 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_002985 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_002985 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU120731 MISSION® esiRNA esiRNA human CCL5 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_002985 Rosetta Predictions human pricing
NM_031116 Rosetta Predictions rat pricing
NM_013653 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_002985 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00155209 predicted 196
2 SASI_Hs01_00155210 predicted 249
3 SASI_Hs01_00155211 predicted 278
4 SASI_Hs01_00155212 predicted 244
5 SASI_Hs01_00155213 predicted 200
6 SASI_Hs01_00155214 predicted 197
7 SASI_Hs01_00155216 predicted 221
8 SASI_Hs01_00155217 predicted 243
9 SASI_Hs01_00155218 predicted 262
10 SASI_Hs02_00334862 predicted 241
11 SASI_Hs01_00155215 predicted 281
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_031116 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00264417 predicted 282
2 SASI_Rn01_00089370 predicted 207
3 SASI_Rn01_00089371 predicted 215
4 SASI_Rn02_00264418 predicted 332
5 SASI_Rn01_00089372 predicted 221
6 SASI_Rn01_00089373 predicted 273
7 SASI_Rn02_00264419 predicted 342
8 SASI_Rn01_00089374 predicted 221
9 SASI_Rn02_00264420 predicted 277
10 SASI_Rn02_00264421 predicted 247
11 SASI_Rn01_00089366 predicted 320
12 SASI_Rn01_00089367 predicted 319
13 SASI_Rn01_00089368 predicted 223
14 SASI_Rn01_00089369 predicted 240
15 SASI_Rn01_00089375 predicted 221
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_013653 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00322475 predicted 289
2 SASI_Mm01_00139178 predicted 225
3 SASI_Mm01_00139179 predicted 213
4 SASI_Mm01_00139180 predicted 224
5 SASI_Mm01_00139182 predicted 228
6 SASI_Mm01_00139183 predicted 213
7 SASI_Mm01_00139184 predicted 221
8 SASI_Mm01_00139185 predicted 243
9 SASI_Mm02_00322476 predicted 296
10 SASI_Mm01_00139186 predicted 289
11 SASI_Mm01_00139177 predicted 301
12 SASI_Mm01_00139181 predicted 227
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_013653
CCL5 MISSION shRNA Bacterial Glycerol Stock
chemokine (C-C motif) ligand 5
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000068098    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_013653.1-327s1c1
Sequence:CCGGTCTTGATTCTGACCCTGTATACTCGAGTATACAGGGTCAGAATCAAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000068099    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013653.1-265s1c1
Sequence:CCGGCCAGAGAAGAAGTGGGTTCAACTCGAGTTGAACCCACTTCTTCTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000068101    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013653.1-174s1c1
Sequence:CCGGCCACGTCAAGGAGTATTTCTACTCGAGTAGAAATACTCCTTGACGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000068102    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013653.1-210s1c1
Sequence:CCGGCTCCAATCTTGCAGTCGTGTTCTCGAGAACACGACTGCAAGATTGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000068100    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013653.1-225s1c1
Sequence:CCGGCGTGTTTGTCACTCGAAGGAACTCGAGTTCCTTCGAGTGACAAACACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_013653
CCL5 MISSION shRNA shRNA Plasmid DNA
chemokine (C-C motif) ligand 5
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000068098    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_013653.1-327s1c1
Sequence:CCGGTCTTGATTCTGACCCTGTATACTCGAGTATACAGGGTCAGAATCAAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000068099    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013653.1-265s1c1
Sequence:CCGGCCAGAGAAGAAGTGGGTTCAACTCGAGTTGAACCCACTTCTTCTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000068101    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013653.1-174s1c1
Sequence:CCGGCCACGTCAAGGAGTATTTCTACTCGAGTAGAAATACTCCTTGACGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000068102    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013653.1-210s1c1
Sequence:CCGGCTCCAATCTTGCAGTCGTGTTCTCGAGAACACGACTGCAAGATTGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000068100    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013653.1-225s1c1
Sequence:CCGGCGTGTTTGTCACTCGAAGGAACTCGAGTTCCTTCGAGTGACAAACACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_013653
CCL5 MISSION shRNA Lentiviral Transduction Particles
chemokine (C-C motif) ligand 5
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000068098    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_013653.1-327s1c1
Sequence:CCGGTCTTGATTCTGACCCTGTATACTCGAGTATACAGGGTCAGAATCAAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000068099    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013653.1-265s1c1
Sequence:CCGGCCAGAGAAGAAGTGGGTTCAACTCGAGTTGAACCCACTTCTTCTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000068101    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013653.1-174s1c1
Sequence:CCGGCCACGTCAAGGAGTATTTCTACTCGAGTAGAAATACTCCTTGACGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000068102    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013653.1-210s1c1
Sequence:CCGGCTCCAATCTTGCAGTCGTGTTCTCGAGAACACGACTGCAAGATTGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000068100    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013653.1-225s1c1
Sequence:CCGGCGTGTTTGTCACTCGAAGGAACTCGAGTTCCTTCGAGTGACAAACACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_002985
CCL5 MISSION shRNA Bacterial Glycerol Stock
chemokine (C-C motif) ligand 5
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000058004    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002985.2-203s1c1
Sequence:CCGGCCACATCAAGGAGTATTTCTACTCGAGTAGAAATACTCCTTGATGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000058007    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002985.2-198s1c1
Sequence:CCGGCGTGCCCACATCAAGGAGTATCTCGAGATACTCCTTGATGTGGGCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000058006    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002985.2-302s1c1
Sequence:CCGGGAAATGGGTTCGGGAGTACATCTCGAGATGTACTCCCGAACCCATTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000058005    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002985.2-215s1c1
Sequence:CCGGGTATTTCTACACCAGTGGCAACTCGAGTTGCCACTGGTGTAGAAATACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000058003    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002985.2-254s1c1
Sequence:CCGGCGTCTTTGTCACCCGAAAGAACTCGAGTTCTTTCGGGTGACAAAGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000377748    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002985.2-464s21c1
Sequence:CCGGCTACCACACAGCAGCAGTTACCTCGAGGTAACTGCTGCTGTGTGGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000371691    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002985.2-358s21c1
Sequence:CCGGTGAACCTGAACTTACACAAATCTCGAGATTTGTGTAAGTTCAGGTTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000371627    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002985.2-163s21c1
Sequence:CCGGCCTGCTGCTTTGCCTACATTGCTCGAGCAATGTAGGCAAAGCAGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_002985
CCL5 MISSION shRNA shRNA Plasmid DNA
chemokine (C-C motif) ligand 5
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000058004    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002985.2-203s1c1
Sequence:CCGGCCACATCAAGGAGTATTTCTACTCGAGTAGAAATACTCCTTGATGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000058007    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002985.2-198s1c1
Sequence:CCGGCGTGCCCACATCAAGGAGTATCTCGAGATACTCCTTGATGTGGGCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000058006    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002985.2-302s1c1
Sequence:CCGGGAAATGGGTTCGGGAGTACATCTCGAGATGTACTCCCGAACCCATTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000058005    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002985.2-215s1c1
Sequence:CCGGGTATTTCTACACCAGTGGCAACTCGAGTTGCCACTGGTGTAGAAATACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000058003    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002985.2-254s1c1
Sequence:CCGGCGTCTTTGTCACCCGAAAGAACTCGAGTTCTTTCGGGTGACAAAGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000377748    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002985.2-464s21c1
Sequence:CCGGCTACCACACAGCAGCAGTTACCTCGAGGTAACTGCTGCTGTGTGGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000371691    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002985.2-358s21c1
Sequence:CCGGTGAACCTGAACTTACACAAATCTCGAGATTTGTGTAAGTTCAGGTTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000371627    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002985.2-163s21c1
Sequence:CCGGCCTGCTGCTTTGCCTACATTGCTCGAGCAATGTAGGCAAAGCAGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_002985
CCL5 MISSION shRNA Lentiviral Transduction Particles
chemokine (C-C motif) ligand 5
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000058004    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002985.2-203s1c1
Sequence:CCGGCCACATCAAGGAGTATTTCTACTCGAGTAGAAATACTCCTTGATGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000058007    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002985.2-198s1c1
Sequence:CCGGCGTGCCCACATCAAGGAGTATCTCGAGATACTCCTTGATGTGGGCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000058006    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002985.2-302s1c1
Sequence:CCGGGAAATGGGTTCGGGAGTACATCTCGAGATGTACTCCCGAACCCATTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000058005    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002985.2-215s1c1
Sequence:CCGGGTATTTCTACACCAGTGGCAACTCGAGTTGCCACTGGTGTAGAAATACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000058003    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002985.2-254s1c1
Sequence:CCGGCGTCTTTGTCACCCGAAAGAACTCGAGTTCTTTCGGGTGACAAAGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000377748    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002985.2-464s21c1
Sequence:CCGGCTACCACACAGCAGCAGTTACCTCGAGGTAACTGCTGCTGTGTGGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000371691    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002985.2-358s21c1
Sequence:CCGGTGAACCTGAACTTACACAAATCTCGAGATTTGTGTAAGTTCAGGTTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000371627    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002985.2-163s21c1
Sequence:CCGGCCTGCTGCTTTGCCTACATTGCTCGAGCAATGTAGGCAAAGCAGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks