EMAIL THIS PAGE TO A FRIEND

CCL7

chemokine (C-C motif) ligand 7

85 Gene Product Result for
Synonyms: FIC MARC MCP-3 MCP3 NC28 SCYA6 SCYA7
UniProtKB ID: P80098, Q569J6
Gene ID:
Human(6354) Summary: This gene encodes monocyte chemotactic protein 3, a secreted chemokine which attracts macrophages during inflammation and metastasis. It is a member of the C-C subfamily of chemokines which are characterized by having two adjacent cysteine residues. The protein is an in vivo substrate of matrix metalloproteinase 2, an enzyme which degrades components of the extracellular matrix. This gene is part of a cluster of C-C chemokine family members on chromosome 17q. [provided by RefSeq, Jul 2008]
Mouse(20306) chemokine (C-C motif) ligand 7
Rat(287561) chemokine (C-C motif) ligand 7
domestic cat(101096931) chemokine (C-C motif) ligand 7
dog(491148) chemokine (C-C motif) ligand 7
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

AQUA Peptides

Product # Description Species Add to Cart
 
AQ0097 AQUA Peptide EAVI[F]K cow, dog, human, pig pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_013654 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_013654 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_013654 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_006273 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_006273 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_006273 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU138521 MISSION® esiRNA esiRNA human CCL7 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_006273 Rosetta Predictions human pricing
NM_001007612 Rosetta Predictions rat pricing
NM_013654 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_006273 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00217486 predicted 220
2 SASI_Hs01_00217487 predicted 244
3 SASI_Hs01_00217488 predicted 246
4 SASI_Hs01_00217489 predicted 195
5 SASI_Hs01_00217490 predicted 482
6 SASI_Hs01_00217491 predicted 702
7 SASI_Hs01_00217492 predicted 591
8 SASI_Hs01_00217494 predicted 716
9 SASI_Hs01_00217495 predicted 302
10 SASI_Hs02_00341237 predicted 727
11 SASI_Hs01_00217493 predicted 376
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001007612 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00095855 predicted 568
2 SASI_Rn01_00095856 predicted 565
3 SASI_Rn02_00198702 predicted 490
4 SASI_Rn01_00095858 predicted 328
5 SASI_Rn01_00095859 predicted 517
6 SASI_Rn01_00095860 predicted 374
7 SASI_Rn01_00095861 predicted 526
8 SASI_Rn01_00095862 predicted 578
9 SASI_Rn01_00095863 predicted 320
10 SASI_Rn01_00095864 predicted 517
11 SASI_Rn01_00095857 predicted 299
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_013654 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00322477 predicted 500
2 SASI_Mm01_00179135 predicted 356
3 SASI_Mm01_00179136 predicted 545
4 SASI_Mm01_00179137 predicted 275
5 SASI_Mm01_00179139 predicted 565
6 SASI_Mm01_00179140 predicted 319
7 SASI_Mm01_00179141 predicted 552
8 SASI_Mm01_00179142 predicted 554
9 SASI_Mm01_00179143 predicted 349
10 SASI_Mm01_00179144 predicted 505
11 SASI_Mm01_00179138 predicted 510
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_013654
VALIDATED
CCL7 MISSION shRNA Bacterial Glycerol Stock
chemokine (C-C motif) ligand 7
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000068135    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_013654.2-313s1c1
Sequence:CCGGCGAGGAGGCTATAGCATACTTCTCGAGAAGTATGCTATAGCCTCCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000068136    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_013654.2-110s1c1
Sequence:CCGGGCCGCTGCTTTCAGCATCCAACTCGAGTTGGATGCTGAAAGCAGCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000068133    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013654.2-168s1c1
Sequence:CCGGGCTGCTATGTCAAGAAACAAACTCGAGTTTGTTTCTTGACATAGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000068137    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013654.2-100s1c1
Sequence:CCGGGCTGCTCATAGCCGCTGCTTTCTCGAGAAAGCAGCGGCTATGAGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000068134    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013654.2-250s1c1
Sequence:CCGGAGCTGTTATCTTCAAGACAAACTCGAGTTTGTCTTGAAGATAACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000317599    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_013654.3-315s21c1
Sequence:CCGGCGAGGAGGCTATAGCATACTTCTCGAGAAGTATGCTATAGCCTCCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000319408    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013654.3-218s21c1
Sequence:CCGGACAGAAGGATCACCAGTAGTCCTCGAGGACTACTGGTGATCCTTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000319481    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_013654.3-255s21c1
Sequence:CCGGTGTTATCTTCAAGACAAAGAACTCGAGTTCTTTGTCTTGAAGATAACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000319480    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.79 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_013654.3-506s21c1
Sequence:CCGGACGCCTAAGGAATGGTCTTTACTCGAGTAAAGACCATTCCTTAGGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000350008    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013654.3-167s21c1
Sequence:CCGGCATGCTGCTATGTCAAGAAACCTCGAGGTTTCTTGACATAGCAGCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_013654
VALIDATED
CCL7 MISSION shRNA shRNA Plasmid DNA
chemokine (C-C motif) ligand 7
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000068135    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_013654.2-313s1c1
Sequence:CCGGCGAGGAGGCTATAGCATACTTCTCGAGAAGTATGCTATAGCCTCCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000068136    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_013654.2-110s1c1
Sequence:CCGGGCCGCTGCTTTCAGCATCCAACTCGAGTTGGATGCTGAAAGCAGCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000068133    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013654.2-168s1c1
Sequence:CCGGGCTGCTATGTCAAGAAACAAACTCGAGTTTGTTTCTTGACATAGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000068137    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013654.2-100s1c1
Sequence:CCGGGCTGCTCATAGCCGCTGCTTTCTCGAGAAAGCAGCGGCTATGAGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000068134    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013654.2-250s1c1
Sequence:CCGGAGCTGTTATCTTCAAGACAAACTCGAGTTTGTCTTGAAGATAACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000317599    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_013654.3-315s21c1
Sequence:CCGGCGAGGAGGCTATAGCATACTTCTCGAGAAGTATGCTATAGCCTCCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000319408    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013654.3-218s21c1
Sequence:CCGGACAGAAGGATCACCAGTAGTCCTCGAGGACTACTGGTGATCCTTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000319481    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_013654.3-255s21c1
Sequence:CCGGTGTTATCTTCAAGACAAAGAACTCGAGTTCTTTGTCTTGAAGATAACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000319480    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.79 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_013654.3-506s21c1
Sequence:CCGGACGCCTAAGGAATGGTCTTTACTCGAGTAAAGACCATTCCTTAGGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000350008    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013654.3-167s21c1
Sequence:CCGGCATGCTGCTATGTCAAGAAACCTCGAGGTTTCTTGACATAGCAGCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_013654
VALIDATED
CCL7 MISSION shRNA Lentiviral Transduction Particles
chemokine (C-C motif) ligand 7
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000068135    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_013654.2-313s1c1
Sequence:CCGGCGAGGAGGCTATAGCATACTTCTCGAGAAGTATGCTATAGCCTCCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000068136    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_013654.2-110s1c1
Sequence:CCGGGCCGCTGCTTTCAGCATCCAACTCGAGTTGGATGCTGAAAGCAGCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000068133    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013654.2-168s1c1
Sequence:CCGGGCTGCTATGTCAAGAAACAAACTCGAGTTTGTTTCTTGACATAGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000068137    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013654.2-100s1c1
Sequence:CCGGGCTGCTCATAGCCGCTGCTTTCTCGAGAAAGCAGCGGCTATGAGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000068134    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013654.2-250s1c1
Sequence:CCGGAGCTGTTATCTTCAAGACAAACTCGAGTTTGTCTTGAAGATAACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000317599    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_013654.3-315s21c1
Sequence:CCGGCGAGGAGGCTATAGCATACTTCTCGAGAAGTATGCTATAGCCTCCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000319408    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013654.3-218s21c1
Sequence:CCGGACAGAAGGATCACCAGTAGTCCTCGAGGACTACTGGTGATCCTTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000319481    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_013654.3-255s21c1
Sequence:CCGGTGTTATCTTCAAGACAAAGAACTCGAGTTCTTTGTCTTGAAGATAACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000319480    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.79 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_013654.3-506s21c1
Sequence:CCGGACGCCTAAGGAATGGTCTTTACTCGAGTAAAGACCATTCCTTAGGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000350008    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013654.3-167s21c1
Sequence:CCGGCATGCTGCTATGTCAAGAAACCTCGAGGTTTCTTGACATAGCAGCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_006273
CCL7 MISSION shRNA Bacterial Glycerol Stock
chemokine (C-C motif) ligand 7
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000057893    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006273.2-171s1c1
Sequence:CCGGGCTGCTACAGATTTATCAATACTCGAGTATTGATAAATCTGTAGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000057895    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006273.2-250s1c1
Sequence:CCGGCCGGGAAGCTGTAATCTTCAACTCGAGTTGAAGATTACAGCTTCCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000057897    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006273.2-257s1c1
Sequence:CCGGGCTGTAATCTTCAAGACCAAACTCGAGTTTGGTCTTGAAGATTACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000057896    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006273.2-146s1c1
Sequence:CCGGGTTGGGATTAATACTTCAACTCTCGAGAGTTGAAGTATTAATCCCAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000057894    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006273.2-319s1c1
Sequence:CCGGCCAGGACTTTATGAAGCACCTCTCGAGAGGTGCTTCATAAAGTCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000371692    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006273.2-356s21c1
Sequence:CCGGACTCCAAAGCTTTGAACATTCCTCGAGGAATGTTCAAAGCTTTGGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000371693    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006273.2-471s21c1
Sequence:CCGGTCTAAGGAATATGAGCTTTATCTCGAGATAAAGCTCATATTCCTTAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000371694    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006273.2-582s21c1
Sequence:CCGGCATAAAGCCTTGGATGTATATCTCGAGATATACATCCAAGGCTTTATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_006273
CCL7 MISSION shRNA shRNA Plasmid DNA
chemokine (C-C motif) ligand 7
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000057893    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006273.2-171s1c1
Sequence:CCGGGCTGCTACAGATTTATCAATACTCGAGTATTGATAAATCTGTAGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000057895    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006273.2-250s1c1
Sequence:CCGGCCGGGAAGCTGTAATCTTCAACTCGAGTTGAAGATTACAGCTTCCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000057897    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006273.2-257s1c1
Sequence:CCGGGCTGTAATCTTCAAGACCAAACTCGAGTTTGGTCTTGAAGATTACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000057896    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006273.2-146s1c1
Sequence:CCGGGTTGGGATTAATACTTCAACTCTCGAGAGTTGAAGTATTAATCCCAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000057894    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006273.2-319s1c1
Sequence:CCGGCCAGGACTTTATGAAGCACCTCTCGAGAGGTGCTTCATAAAGTCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000371692    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006273.2-356s21c1
Sequence:CCGGACTCCAAAGCTTTGAACATTCCTCGAGGAATGTTCAAAGCTTTGGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000371693    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006273.2-471s21c1
Sequence:CCGGTCTAAGGAATATGAGCTTTATCTCGAGATAAAGCTCATATTCCTTAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000371694    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006273.2-582s21c1
Sequence:CCGGCATAAAGCCTTGGATGTATATCTCGAGATATACATCCAAGGCTTTATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_006273
CCL7 MISSION shRNA Lentiviral Transduction Particles
chemokine (C-C motif) ligand 7
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000057893    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006273.2-171s1c1
Sequence:CCGGGCTGCTACAGATTTATCAATACTCGAGTATTGATAAATCTGTAGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000057895    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006273.2-250s1c1
Sequence:CCGGCCGGGAAGCTGTAATCTTCAACTCGAGTTGAAGATTACAGCTTCCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000057897    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006273.2-257s1c1
Sequence:CCGGGCTGTAATCTTCAAGACCAAACTCGAGTTTGGTCTTGAAGATTACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000057896    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006273.2-146s1c1
Sequence:CCGGGTTGGGATTAATACTTCAACTCTCGAGAGTTGAAGTATTAATCCCAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000057894    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006273.2-319s1c1
Sequence:CCGGCCAGGACTTTATGAAGCACCTCTCGAGAGGTGCTTCATAAAGTCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000371692    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006273.2-356s21c1
Sequence:CCGGACTCCAAAGCTTTGAACATTCCTCGAGGAATGTTCAAAGCTTTGGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000371693    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006273.2-471s21c1
Sequence:CCGGTCTAAGGAATATGAGCTTTATCTCGAGATAAAGCTCATATTCCTTAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000371694    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006273.2-582s21c1
Sequence:CCGGCATAAAGCCTTGGATGTATATCTCGAGATATACATCCAAGGCTTTATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks