EMAIL THIS PAGE TO A FRIEND

CCL8

chemokine (C-C motif) ligand 8

75 Gene Product Result for
Synonyms: HC14 MCP-2 MCP2 SCYA10 SCYA8
UniProtKB ID: P80075, A0AV77, P78388
Gene ID:
Human(6355) Summary: This gene is one of several cytokine genes clustered on the q-arm of chromosome 17. Cytokines are a family of secreted proteins involved in immunoregulatory and inflammatory processes. The protein encoded by this gene is structurally related to the CXC subfamily of cytokines. Members of this subfamily are characterized by two cysteines separated by a single amino acid. This cytokine displays chemotactic activity for monocytes, lymphocytes, basophils and eosinophils. By recruiting leukocytes to sites of inflammation this cytokine may contribute to tumor-associated leukocyte infiltration and to the antiviral state against HIV infection. [provided by RefSeq, Jul 2008]
Mouse(20307) chemokine (C-C motif) ligand 8
dog(448792) chemokine (C-C motif) ligand 8
cow(281044) chemokine (C-C motif) ligand 8
cow(788169) C-C motif chemokine 8-like
Horse(100033927) chemokine (C-C motif) ligand 8
domestic cat(101097189) chemokine (C-C motif) ligand 8
naked mole-rat(101699218) chemokine (C-C motif) ligand 8
sheep(101119572) chemokine (C-C motif) ligand 8
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

AQUA Peptides

Product # Description Species Add to Cart
 
AQ0097 AQUA Peptide EAVI[F]K cow, dog, human, pig pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_005623 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_005623 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_005623 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_021443 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_021443 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_021443 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_005623 Rosetta Predictions human pricing
NM_021443 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_005623 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00123711 predicted 591
2 SASI_Hs01_00123712 predicted 548
3 SASI_Hs01_00123713 predicted 596
4 SASI_Hs01_00123714 predicted 524
5 SASI_Hs01_00123715 predicted 592
6 SASI_Hs01_00123716 predicted 555
7 SASI_Hs01_00123717 predicted 544
8 SASI_Hs01_00123718 predicted 491
9 SASI_Hs01_00123719 predicted 495
10 SASI_Hs01_00123720 predicted 614
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_021443 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00062325 predicted 257
2 SASI_Mm01_00062326 predicted 200
3 SASI_Mm01_00062327 predicted 196
4 SASI_Mm01_00062328 predicted 247
5 SASI_Mm01_00062330 predicted 284
6 SASI_Mm01_00062331 predicted 197
7 SASI_Mm01_00062329 predicted 199
8 SASI_Mm02_00326090 predicted 288
9 SASI_Mm02_00326091 predicted 462
10 SASI_Mm01_00062332 predicted 111
11 SASI_Mm01_00062333 predicted 150
12 SASI_Mm01_00062334 predicted 320
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_005623
CCL8 MISSION shRNA Bacterial Glycerol Stock
chemokine (C-C motif) ligand 8
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000377690    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005623.2-1155s21c1
Sequence:CCGGTTGTACTGCTGTTGTTGAAATCTCGAGATTTCAACAACAGCAGTACAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000371696    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005623.2-748s21c1
Sequence:CCGGAGCCATGAGCCTTCATACATGCTCGAGCATGTATGAAGGCTCATGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000371695    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005623.2-821s21c1
Sequence:CCGGCAGGTGCAGTGTGACATTATTCTCGAGAATAATGTCACACTGCACCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000057948    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005623.2-596s1c1
Sequence:CCGGGCTGGAGAGCTACACAAGAATCTCGAGATTCTTGTGTAGCTCTCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000057949    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005623.2-556s1c1
Sequence:CCGGGCTGCTTTAACGTGATCAATACTCGAGTATTGATCACGTTAAAGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000057950    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005623.2-530s1c1
Sequence:CCGGAGATTCAGTTTCCATTCCAATCTCGAGATTGGAATGGAAACTGAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000057951    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005623.2-602s1c1
Sequence:CCGGGAGCTACACAAGAATCACCAACTCGAGTTGGTGATTCTTGTGTAGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000057952    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005623.2-712s1c1
Sequence:CCGGCCATGAAGCATCTGGACCAAACTCGAGTTTGGTCCAGATGCTTCATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_005623
CCL8 MISSION shRNA shRNA Plasmid DNA
chemokine (C-C motif) ligand 8
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000377690    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005623.2-1155s21c1
Sequence:CCGGTTGTACTGCTGTTGTTGAAATCTCGAGATTTCAACAACAGCAGTACAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000371696    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005623.2-748s21c1
Sequence:CCGGAGCCATGAGCCTTCATACATGCTCGAGCATGTATGAAGGCTCATGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000371695    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005623.2-821s21c1
Sequence:CCGGCAGGTGCAGTGTGACATTATTCTCGAGAATAATGTCACACTGCACCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000057948    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005623.2-596s1c1
Sequence:CCGGGCTGGAGAGCTACACAAGAATCTCGAGATTCTTGTGTAGCTCTCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000057949    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005623.2-556s1c1
Sequence:CCGGGCTGCTTTAACGTGATCAATACTCGAGTATTGATCACGTTAAAGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000057950    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005623.2-530s1c1
Sequence:CCGGAGATTCAGTTTCCATTCCAATCTCGAGATTGGAATGGAAACTGAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000057951    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005623.2-602s1c1
Sequence:CCGGGAGCTACACAAGAATCACCAACTCGAGTTGGTGATTCTTGTGTAGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000057952    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005623.2-712s1c1
Sequence:CCGGCCATGAAGCATCTGGACCAAACTCGAGTTTGGTCCAGATGCTTCATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_005623
CCL8 MISSION shRNA Lentiviral Transduction Particles
chemokine (C-C motif) ligand 8
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000377690    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005623.2-1155s21c1
Sequence:CCGGTTGTACTGCTGTTGTTGAAATCTCGAGATTTCAACAACAGCAGTACAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000371696    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005623.2-748s21c1
Sequence:CCGGAGCCATGAGCCTTCATACATGCTCGAGCATGTATGAAGGCTCATGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000371695    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005623.2-821s21c1
Sequence:CCGGCAGGTGCAGTGTGACATTATTCTCGAGAATAATGTCACACTGCACCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000057948    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005623.2-596s1c1
Sequence:CCGGGCTGGAGAGCTACACAAGAATCTCGAGATTCTTGTGTAGCTCTCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000057949    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005623.2-556s1c1
Sequence:CCGGGCTGCTTTAACGTGATCAATACTCGAGTATTGATCACGTTAAAGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000057950    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005623.2-530s1c1
Sequence:CCGGAGATTCAGTTTCCATTCCAATCTCGAGATTGGAATGGAAACTGAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000057951    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005623.2-602s1c1
Sequence:CCGGGAGCTACACAAGAATCACCAACTCGAGTTGGTGATTCTTGTGTAGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000057952    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005623.2-712s1c1
Sequence:CCGGCCATGAAGCATCTGGACCAAACTCGAGTTTGGTCCAGATGCTTCATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_021443
VALIDATED
CCL8 MISSION shRNA Bacterial Glycerol Stock
chemokine (C-C motif) ligand 8
Mouse
3 Products Total
TRC Number Price Set Price (3)? Select
TRCN0000068173    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021443.1-322s1c1
Sequence:CCGGCTTGACCAGAAGTCTCAAATTCTCGAGAATTTGAGACTTCTGGTCAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000068176    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_021443.1-207s1c1
Sequence:CCGGCGAGAGAATCAACAATATCCACTCGAGTGGATATTGTTGATTCTCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000068177    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_021443.1-312s1c1
Sequence:CCGGCATGGAGATCCTTGACCAGAACTCGAGTTCTGGTCAAGGATCTCCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_021443
VALIDATED
CCL8 MISSION shRNA shRNA Plasmid DNA
chemokine (C-C motif) ligand 8
Mouse
3 Products Total
TRC Number Vector Price Set Price (3)? Select
TRCN0000068173    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021443.1-322s1c1
Sequence:CCGGCTTGACCAGAAGTCTCAAATTCTCGAGAATTTGAGACTTCTGGTCAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000068176    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_021443.1-207s1c1
Sequence:CCGGCGAGAGAATCAACAATATCCACTCGAGTGGATATTGTTGATTCTCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000068177    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_021443.1-312s1c1
Sequence:CCGGCATGGAGATCCTTGACCAGAACTCGAGTTCTGGTCAAGGATCTCCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_021443
VALIDATED
CCL8 MISSION shRNA Lentiviral Transduction Particles
chemokine (C-C motif) ligand 8
Mouse
3 Products Total
TRC Number Volume Titer Vector Price Set Price (3)? Select
TRCN0000068173    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021443.1-322s1c1
Sequence:CCGGCTTGACCAGAAGTCTCAAATTCTCGAGAATTTGAGACTTCTGGTCAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000068176    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_021443.1-207s1c1
Sequence:CCGGCGAGAGAATCAACAATATCCACTCGAGTGGATATTGTTGATTCTCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000068177    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_021443.1-312s1c1
Sequence:CCGGCATGGAGATCCTTGACCAGAACTCGAGTTCTGGTCAAGGATCTCCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks