EMAIL THIS PAGE TO A FRIEND

CCM2

cerebral cavernous malformation 2

188 Gene Product Result for
Synonyms: C7orf22 OSM
Gene ID:
Human(83605) Summary: This gene encodes a scaffold protein that functions in the stress-activated p38 Mitogen-activated protein kinase (MAPK) signaling cascade. The protein interacts with SMAD specific E3 ubiquitin protein ligase 1 (also known as SMURF1) via a phosphotyrosine binding domain to promote RhoA degradation. The protein is required for normal cytoskeletal structure, cell-cell interactions, and lumen formation in endothelial cells. Mutations in this gene result in cerebral cavernous malformations. Multiple transcript variants encoding different isoforms have been found for this gene.[provided by RefSeq, Nov 2009]
Mouse(216527) cerebral cavernous malformation 2
Rat(305505) cerebral cavernous malformation 2
Zebrafish(436586) cerebral cavernous malformation 2
chicken(420410) cerebral cavernous malformation 2
cow(506450) cerebral cavernous malformation 2
Horse(100065340) cerebral cavernous malformation 2
domestic cat(101100375) cerebral cavernous malformation 2
dog(475502) cerebral cavernous malformation 2
domestic guinea pig(100716240) cerebral cavernous malformation 2
naked mole-rat(101711971) cerebral cavernous malformation 2
sheep(101114100) cerebral cavernous malformation 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_031443 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_031443 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_031443 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_146014 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_146014 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_146014 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001029835 Rosetta Predictions human pricing
NM_031443 Rosetta Predictions human pricing
NM_001126275 Rosetta Predictions rat pricing
NM_146014 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001029835 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00065480 predicted 1362
2 SASI_Hs01_00065481 predicted 629
3 SASI_Hs01_00065483 predicted 1118
4 SASI_Hs01_00065484 predicted 678
5 SASI_Hs01_00065485 predicted 1113
6 SASI_Hs01_00065486 predicted 644
7 SASI_Hs01_00065487 predicted 1173
8 SASI_Hs01_00065488 predicted 1300
9 SASI_Hs01_00065489 predicted 1054
10 SASI_Hs02_00307520 predicted 829
11 SASI_Hs01_00065482 predicted 825
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_031443 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00019892 predicted 1127
2 SASI_Hs01_00019893 predicted 393
3 SASI_Hs01_00019895 predicted 878
4 SASI_Hs01_00019896 predicted 443
5 SASI_Hs01_00019897 predicted 879
6 SASI_Hs01_00019898 predicted 408
7 SASI_Hs01_00019899 predicted 934
8 SASI_Hs01_00019900 predicted 1064
9 SASI_Hs01_00019901 predicted 824
10 SASI_Hs02_00358852 predicted 589
11 SASI_Hs01_00019894 predicted 595
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001126275 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00253123 predicted 1346
2 SASI_Rn02_00253124 predicted 353
3 SASI_Rn02_00253125 predicted 775
4 SASI_Rn02_00253126 predicted 221
5 SASI_Rn02_00253127 predicted 956
6 SASI_Rn02_00253128 predicted 289
7 SASI_Rn02_00253129 predicted 229
8 SASI_Rn02_00253130 predicted 636
9 SASI_Rn02_00253131 predicted 798
10 SASI_Rn02_00253132 predicted 698
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_146014 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00113480 predicted 239
2 SASI_Mm01_00113481 predicted 296
3 SASI_Mm01_00113482 predicted 1347
4 SASI_Mm01_00113483 predicted 240
5 SASI_Mm02_00341567 predicted 713
6 SASI_Mm01_00113484 predicted 617
7 SASI_Mm01_00113485 predicted 235
8 SASI_Mm01_00113486 predicted 292
9 SASI_Mm01_00113487 predicted 989
10 SASI_Mm01_00113488 predicted 1347
11 SASI_Mm01_00113489 predicted 782
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_031443
CCM2 MISSION shRNA Bacterial Glycerol Stock
cerebral cavernous malformation 2
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000437822    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031443.3-1422s21c1
Sequence:CCGGTCGGACATCAGCAGCGACATTCTCGAGAATGTCGCTGCTGATGTCCGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000421246    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031443.3-273s21c1
Sequence:CCGGCACACTGTGGTGTTGTCATTGCTCGAGCAATGACAACACCACAGTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000426921    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031443.3-788s21c1
Sequence:CCGGCCAGGTCTTCCAGGTTGTTTACTCGAGTAAACAACCTGGAAGACCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000083233    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_031443.2-1551s1c1
Sequence:CCGGGCCCAGGTCCTCTACTGTGAACTCGAGTTCACAGTAGAGGACCTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000083236    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031443.2-264s1c1
Sequence:CCGGCTATATTGAGAAGGAGGTAAACTCGAGTTTACCTCCTTCTCAATATAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000083237    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031443.2-255s1c1
Sequence:CCGGGCTGAGCGACTATATTGAGAACTCGAGTTCTCAATATAGTCGCTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000083235    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031443.2-348s1c1
Sequence:CCGGGCATTTCATAGACAATGCAAACTCGAGTTTGCATTGTCTATGAAATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000083234    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031443.2-112s1c1
Sequence:CCGGCCTGGAATTGTCTCGCCATTTCTCGAGAAATGGCGAGACAATTCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_031443
CCM2 MISSION shRNA shRNA Plasmid DNA
cerebral cavernous malformation 2
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000437822    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031443.3-1422s21c1
Sequence:CCGGTCGGACATCAGCAGCGACATTCTCGAGAATGTCGCTGCTGATGTCCGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000421246    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031443.3-273s21c1
Sequence:CCGGCACACTGTGGTGTTGTCATTGCTCGAGCAATGACAACACCACAGTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000426921    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031443.3-788s21c1
Sequence:CCGGCCAGGTCTTCCAGGTTGTTTACTCGAGTAAACAACCTGGAAGACCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000083233    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_031443.2-1551s1c1
Sequence:CCGGGCCCAGGTCCTCTACTGTGAACTCGAGTTCACAGTAGAGGACCTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000083236    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031443.2-264s1c1
Sequence:CCGGCTATATTGAGAAGGAGGTAAACTCGAGTTTACCTCCTTCTCAATATAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000083237    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031443.2-255s1c1
Sequence:CCGGGCTGAGCGACTATATTGAGAACTCGAGTTCTCAATATAGTCGCTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000083235    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031443.2-348s1c1
Sequence:CCGGGCATTTCATAGACAATGCAAACTCGAGTTTGCATTGTCTATGAAATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000083234    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031443.2-112s1c1
Sequence:CCGGCCTGGAATTGTCTCGCCATTTCTCGAGAAATGGCGAGACAATTCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_031443
CCM2 MISSION shRNA Lentiviral Transduction Particles
cerebral cavernous malformation 2
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000437822    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031443.3-1422s21c1
Sequence:CCGGTCGGACATCAGCAGCGACATTCTCGAGAATGTCGCTGCTGATGTCCGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000421246    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031443.3-273s21c1
Sequence:CCGGCACACTGTGGTGTTGTCATTGCTCGAGCAATGACAACACCACAGTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000426921    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031443.3-788s21c1
Sequence:CCGGCCAGGTCTTCCAGGTTGTTTACTCGAGTAAACAACCTGGAAGACCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000083233    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_031443.2-1551s1c1
Sequence:CCGGGCCCAGGTCCTCTACTGTGAACTCGAGTTCACAGTAGAGGACCTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000083236    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031443.2-264s1c1
Sequence:CCGGCTATATTGAGAAGGAGGTAAACTCGAGTTTACCTCCTTCTCAATATAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000083237    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031443.2-255s1c1
Sequence:CCGGGCTGAGCGACTATATTGAGAACTCGAGTTCTCAATATAGTCGCTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000083235    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031443.2-348s1c1
Sequence:CCGGGCATTTCATAGACAATGCAAACTCGAGTTTGCATTGTCTATGAAATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000083234    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031443.2-112s1c1
Sequence:CCGGCCTGGAATTGTCTCGCCATTTCTCGAGAAATGGCGAGACAATTCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_146014
VALIDATED
CCM2 MISSION shRNA Bacterial Glycerol Stock
cerebral cavernous malformation 2
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000177414    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_146014.1-1339s1c1
Sequence:CCGGGCATGATTTCAGACATCAGTACTCGAGTACTGATGTCTGAAATCATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000199002    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_146014.1-1594s1c1
Sequence:CCGGGCAGAAACCTCTGTGCCTATTCTCGAGAATAGGCACAGAGGTTTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000198373    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_146014.1-810s1c1
Sequence:CCGGGACATGAAGGACAGTTACGATCTCGAGATCGTAACTGTCCTTCATGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000198459    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_146014.1-218s1c1
Sequence:CCGGGCTGAGCGACTATATTGAGAACTCGAGTTCTCAATATAGTCGCTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000197894    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146014.1-86s1c1
Sequence:CCGGGTCGCCATTTAAACGAGTATTCTCGAGAATACTCGTTTAAATGGCGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_146014
VALIDATED
CCM2 MISSION shRNA shRNA Plasmid DNA
cerebral cavernous malformation 2
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000177414    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_146014.1-1339s1c1
Sequence:CCGGGCATGATTTCAGACATCAGTACTCGAGTACTGATGTCTGAAATCATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000199002    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_146014.1-1594s1c1
Sequence:CCGGGCAGAAACCTCTGTGCCTATTCTCGAGAATAGGCACAGAGGTTTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000198373    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_146014.1-810s1c1
Sequence:CCGGGACATGAAGGACAGTTACGATCTCGAGATCGTAACTGTCCTTCATGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000198459    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_146014.1-218s1c1
Sequence:CCGGGCTGAGCGACTATATTGAGAACTCGAGTTCTCAATATAGTCGCTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000197894    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146014.1-86s1c1
Sequence:CCGGGTCGCCATTTAAACGAGTATTCTCGAGAATACTCGTTTAAATGGCGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_146014
VALIDATED
CCM2 MISSION shRNA Lentiviral Transduction Particles
cerebral cavernous malformation 2
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000177414    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_146014.1-1339s1c1
Sequence:CCGGGCATGATTTCAGACATCAGTACTCGAGTACTGATGTCTGAAATCATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000199002    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_146014.1-1594s1c1
Sequence:CCGGGCAGAAACCTCTGTGCCTATTCTCGAGAATAGGCACAGAGGTTTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000198373    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_146014.1-810s1c1
Sequence:CCGGGACATGAAGGACAGTTACGATCTCGAGATCGTAACTGTCCTTCATGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000198459    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_146014.1-218s1c1
Sequence:CCGGGCTGAGCGACTATATTGAGAACTCGAGTTCTCAATATAGTCGCTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000197894    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146014.1-86s1c1
Sequence:CCGGGTCGCCATTTAAACGAGTATTCTCGAGAATACTCGTTTAAATGGCGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks