EMAIL THIS PAGE TO A FRIEND

CCM2L

cerebral cavernous malformation 2-like

37 Gene Product Result for
Synonyms: C20orf160 dJ310O13.5
UniProtKB ID: Q9NUG4, Q5JYR9, Q8N5F1, Q8N6G8, Q96MD5
Gene ID:
Mouse(228788) cerebral cavernous malformation 2-like
sheep(101112919) cerebral cavernous malformation 2-like
naked mole-rat(101710389) cerebral cavernous malformation 2-like
domestic guinea pig(100717494) cerebral cavernous malformation 2-like
Zebrafish(568661) cerebral cavernous malformation 2-like
cow(525479) cerebral cavernous malformation 2-like
domestic cat(101095093) cerebral cavernous malformation 2-like
dog(609856) cerebral cavernous malformation 2-like
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_145536 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_145536 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_145536 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_080625 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_080625 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_080625 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU152711 MISSION® esiRNA esiRNA human C20orf160 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_080625 Rosetta Predictions human pricing
NM_145536 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_080625 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00142034 predicted 359
2 SASI_Hs01_00142035 predicted 1089
3 SASI_Hs01_00142036 predicted 1119
4 SASI_Hs01_00142037 predicted 1430
5 SASI_Hs01_00142038 predicted 1078
6 SASI_Hs01_00142039 predicted 1680
7 SASI_Hs01_00142040 predicted 1075
8 SASI_Hs01_00142041 predicted 386
9 SASI_Hs01_00142042 predicted 1448
10 SASI_Hs02_00362370 predicted 1059
11 SASI_Hs01_00142043 predicted 1049
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_145536 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00029970 predicted 1122
2 SASI_Mm01_00029971 predicted 989
3 SASI_Mm01_00029972 predicted 405
4 SASI_Mm01_00029973 predicted 422
5 SASI_Mm01_00029974 predicted 166
6 SASI_Mm01_00029975 predicted 97
7 SASI_Mm01_00029976 predicted 132
8 SASI_Mm01_00029977 predicted 353
9 SASI_Mm01_00029978 predicted 1009
10 SASI_Mm01_00029979 predicted 1074
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_145536
CCM2L MISSION shRNA Bacterial Glycerol Stock
cerebral cavernous malformation 2-like
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000201190    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_145536.1-2067s1c1
Sequence:CCGGGCTAAGAAACTGAAGAGACTTCTCGAGAAGTCTCTTCAGTTTCTTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000190339    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_145536.1-2040s1c1
Sequence:CCGGCCTAGAGACCTCTCTTCAATTCTCGAGAATTGAAGAGAGGTCTCTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000189517    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145536.1-166s1c1
Sequence:CCGGCCTGCACTCTATGCCTCTTTACTCGAGTAAAGAGGCATAGAGTGCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000189805    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_145536.1-1654s1c1
Sequence:CCGGGCCGACATCACTCATGACATTCTCGAGAATGTCATGAGTGATGTCGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000447016    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_145536.2-1700s21c1
Sequence:CCGGTGTACCTTCTGGGCTTCTTTCCTCGAGGAAAGAAGCCCAGAAGGTACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000443257    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145536.2-1233s21c1
Sequence:CCGGCATTGCTGCTACGAGACTATCCTCGAGGATAGTCTCGTAGCAGCAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000436024    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145536.2-889s21c1
Sequence:CCGGCCTACTGCAACCTGGTCATTCCTCGAGGAATGACCAGGTTGCAGTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_145536
CCM2L MISSION shRNA shRNA Plasmid DNA
cerebral cavernous malformation 2-like
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000201190    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_145536.1-2067s1c1
Sequence:CCGGGCTAAGAAACTGAAGAGACTTCTCGAGAAGTCTCTTCAGTTTCTTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000190339    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_145536.1-2040s1c1
Sequence:CCGGCCTAGAGACCTCTCTTCAATTCTCGAGAATTGAAGAGAGGTCTCTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000189517    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145536.1-166s1c1
Sequence:CCGGCCTGCACTCTATGCCTCTTTACTCGAGTAAAGAGGCATAGAGTGCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000189805    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_145536.1-1654s1c1
Sequence:CCGGGCCGACATCACTCATGACATTCTCGAGAATGTCATGAGTGATGTCGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000447016    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_145536.2-1700s21c1
Sequence:CCGGTGTACCTTCTGGGCTTCTTTCCTCGAGGAAAGAAGCCCAGAAGGTACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000443257    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145536.2-1233s21c1
Sequence:CCGGCATTGCTGCTACGAGACTATCCTCGAGGATAGTCTCGTAGCAGCAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000436024    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145536.2-889s21c1
Sequence:CCGGCCTACTGCAACCTGGTCATTCCTCGAGGAATGACCAGGTTGCAGTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_145536
CCM2L MISSION shRNA Lentiviral Transduction Particles
cerebral cavernous malformation 2-like
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000201190    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_145536.1-2067s1c1
Sequence:CCGGGCTAAGAAACTGAAGAGACTTCTCGAGAAGTCTCTTCAGTTTCTTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000190339    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_145536.1-2040s1c1
Sequence:CCGGCCTAGAGACCTCTCTTCAATTCTCGAGAATTGAAGAGAGGTCTCTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000189517    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145536.1-166s1c1
Sequence:CCGGCCTGCACTCTATGCCTCTTTACTCGAGTAAAGAGGCATAGAGTGCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000189805    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_145536.1-1654s1c1
Sequence:CCGGGCCGACATCACTCATGACATTCTCGAGAATGTCATGAGTGATGTCGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000447016    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_145536.2-1700s21c1
Sequence:CCGGTGTACCTTCTGGGCTTCTTTCCTCGAGGAAAGAAGCCCAGAAGGTACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000443257    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145536.2-1233s21c1
Sequence:CCGGCATTGCTGCTACGAGACTATCCTCGAGGATAGTCTCGTAGCAGCAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000436024    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145536.2-889s21c1
Sequence:CCGGCCTACTGCAACCTGGTCATTCCTCGAGGAATGACCAGGTTGCAGTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_080625
CCM2L MISSION shRNA Bacterial Glycerol Stock
cerebral cavernous malformation 2-like
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000166703    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_080625.2-998s1c1
Sequence:CCGGCCAGAGTATTGAGTGTGTGGACTCGAGTCCACACACTCAATACTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000166548    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_080625.2-372s1c1
Sequence:CCGGCGCGACAATGAAGAGCTCATTCTCGAGAATGAGCTCTTCATTGTCGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000163004    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_080625.2-2143s1c1
Sequence:CCGGGACCTCAAACTGACCATACTACTCGAGTAGTATGGTCAGTTTGAGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000164850    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_080625.2-164s1c1
Sequence:CCGGCCAGATTCTGCTGTGTGACTACTCGAGTAGTCACACAGCAGAATCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000166504    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_080625.2-1032s1c1
Sequence:CCGGCACTACACATCCACACCTGAACTCGAGTTCAGGTGTGGATGTGTAGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000165399    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_080625.2-1636s1c1
Sequence:CCGGCGCAGAAGACAACTACCTGTACTCGAGTACAGGTAGTTGTCTTCTGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000166099    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_080625.2-1173s1c1
Sequence:CCGGGCTTGGAGCAGTTACAGGATTCTCGAGAATCCTGTAACTGCTCCAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000166505    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_080625.2-185s1c1
Sequence:CCGGCCTGGAGAAAGAGGTCAAGTTCTCGAGAACTTGACCTCTTTCTCCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000417260    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080625.3-976s21c1
Sequence:CCGGCTGTCAGGTCTTCCAGATCATCTCGAGATGATCTGGAAGACCTGACAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_080625
CCM2L MISSION shRNA shRNA Plasmid DNA
cerebral cavernous malformation 2-like
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000166703    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_080625.2-998s1c1
Sequence:CCGGCCAGAGTATTGAGTGTGTGGACTCGAGTCCACACACTCAATACTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000166548    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_080625.2-372s1c1
Sequence:CCGGCGCGACAATGAAGAGCTCATTCTCGAGAATGAGCTCTTCATTGTCGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000163004    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_080625.2-2143s1c1
Sequence:CCGGGACCTCAAACTGACCATACTACTCGAGTAGTATGGTCAGTTTGAGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000164850    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_080625.2-164s1c1
Sequence:CCGGCCAGATTCTGCTGTGTGACTACTCGAGTAGTCACACAGCAGAATCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000166504    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_080625.2-1032s1c1
Sequence:CCGGCACTACACATCCACACCTGAACTCGAGTTCAGGTGTGGATGTGTAGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000165399    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_080625.2-1636s1c1
Sequence:CCGGCGCAGAAGACAACTACCTGTACTCGAGTACAGGTAGTTGTCTTCTGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000166099    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_080625.2-1173s1c1
Sequence:CCGGGCTTGGAGCAGTTACAGGATTCTCGAGAATCCTGTAACTGCTCCAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000166505    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_080625.2-185s1c1
Sequence:CCGGCCTGGAGAAAGAGGTCAAGTTCTCGAGAACTTGACCTCTTTCTCCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000417260    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080625.3-976s21c1
Sequence:CCGGCTGTCAGGTCTTCCAGATCATCTCGAGATGATCTGGAAGACCTGACAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_080625
CCM2L MISSION shRNA Lentiviral Transduction Particles
cerebral cavernous malformation 2-like
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000166703    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_080625.2-998s1c1
Sequence:CCGGCCAGAGTATTGAGTGTGTGGACTCGAGTCCACACACTCAATACTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000166548    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_080625.2-372s1c1
Sequence:CCGGCGCGACAATGAAGAGCTCATTCTCGAGAATGAGCTCTTCATTGTCGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000163004    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_080625.2-2143s1c1
Sequence:CCGGGACCTCAAACTGACCATACTACTCGAGTAGTATGGTCAGTTTGAGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000164850    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_080625.2-164s1c1
Sequence:CCGGCCAGATTCTGCTGTGTGACTACTCGAGTAGTCACACAGCAGAATCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000166504    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_080625.2-1032s1c1
Sequence:CCGGCACTACACATCCACACCTGAACTCGAGTTCAGGTGTGGATGTGTAGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000165399    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_080625.2-1636s1c1
Sequence:CCGGCGCAGAAGACAACTACCTGTACTCGAGTACAGGTAGTTGTCTTCTGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000166099    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_080625.2-1173s1c1
Sequence:CCGGGCTTGGAGCAGTTACAGGATTCTCGAGAATCCTGTAACTGCTCCAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000166505    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_080625.2-185s1c1
Sequence:CCGGCCTGGAGAAAGAGGTCAAGTTCTCGAGAACTTGACCTCTTTCTCCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000417260    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080625.3-976s21c1
Sequence:CCGGCTGTCAGGTCTTCCAGATCATCTCGAGATGATCTGGAAGACCTGACAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks