EMAIL THIS PAGE TO A FRIEND

CCNA1

cyclin A1

144 Gene Product Result for
UniProtKB ID: P78396, B7Z7E3, Q5T3V0, Q5U0G2, Q8IY91
Gene ID:
Human(8900) Summary: The protein encoded by this gene belongs to the highly conserved cyclin family, whose members are characterized by a dramatic periodicity in protein abundance through the cell cycle. Cyclins function as regulators of CDK kinases. Different cyclins exhibit distinct expression and degradation patterns which contribute to the temporal coordination of each mitotic event. The cyclin encoded by this gene was shown to be expressed in testis and brain, as well as in several leukemic cell lines, and is thought to primarily function in the control of the germline meiotic cell cycle. This cyclin binds both CDK2 and CDC2 kinases, which give two distinct kinase activities, one appearing in S phase, the other in G2, and thus regulate separate functions in cell cycle. This cyclin was found to bind to important cell cycle regulators, such as Rb family proteins, transcription factor E2F-1, and the p21 family proteins. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
Mouse(12427) cyclin A1
Rat(295052) cyclin A1
Zebrafish(404206) cyclin A1
cow(521939) cyclin A1
chicken(418901) cyclin A1
dog(477302) cyclin A1
sheep(101105579) cyclin A1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_003914 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_003914 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_003914 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_007628 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_007628 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_007628 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001111045 Rosetta Predictions human pricing
NM_001111046 Rosetta Predictions human pricing
NM_001111047 Rosetta Predictions human pricing
NM_003914 Rosetta Predictions human pricing
NM_001011949 Rosetta Predictions rat pricing
XM_574943 Rosetta Predictions rat pricing
NM_007628 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001111045 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00325176 predicted 957
2 SASI_Hs02_00325177 predicted 1233
3 SASI_Hs02_00325178 predicted 1028
4 SASI_Hs02_00325179 predicted 1274
5 SASI_Hs02_00325180 predicted 1578
6 SASI_Hs02_00325181 predicted 1580
7 SASI_Hs02_00325182 predicted 1553
8 SASI_Hs02_00325183 predicted 1282
9 SASI_Hs02_00325184 predicted 1375
10 SASI_Hs02_00325185 predicted 1260
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001111046 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00325186 predicted 841
2 SASI_Hs02_00325187 predicted 1109
3 SASI_Hs02_00325188 predicted 913
4 SASI_Hs02_00325189 predicted 1158
5 SASI_Hs02_00325190 predicted 1465
6 SASI_Hs02_00325191 predicted 1463
7 SASI_Hs02_00325192 predicted 1439
8 SASI_Hs02_00325193 predicted 1162
9 SASI_Hs02_00325194 predicted 1261
10 SASI_Hs02_00325195 predicted 1138
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001111047 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00325196 predicted 831
2 SASI_Hs02_00325197 predicted 1108
3 SASI_Hs02_00325198 predicted 910
4 SASI_Hs02_00325199 predicted 1158
5 SASI_Hs02_00325200 predicted 1463
6 SASI_Hs02_00325201 predicted 1460
7 SASI_Hs02_00325202 predicted 1435
8 SASI_Hs02_00325203 predicted 1157
9 SASI_Hs02_00325204 predicted 1252
10 SASI_Hs02_00325205 predicted 1144
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_003914 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00217789 predicted 955
2 SASI_Hs01_00217790 predicted 1235
3 SASI_Hs01_00217791 predicted 1030
4 SASI_Hs01_00217792 predicted 1276
5 SASI_Hs01_00217794 predicted 1588
6 SASI_Hs01_00217795 predicted 1581
7 SASI_Hs01_00217796 predicted 1559
8 SASI_Hs01_00217797 predicted 1284
9 SASI_Hs01_00217798 predicted 1384
10 SASI_Hs02_00336551 predicted 1261
11 SASI_Hs01_00217793 predicted 225
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001011949 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00064482 predicted 1377
2 SASI_Rn01_00064483 predicted 1232
3 SASI_Rn01_00064484 predicted 1220
4 SASI_Rn01_00064485 predicted 1389
5 SASI_Rn01_00064486 predicted 1023
6 SASI_Rn01_00064487 predicted 1008
7 SASI_Rn01_00064488 predicted 753
8 SASI_Rn01_00064489 predicted 1416
9 SASI_Rn01_00064490 predicted 1349
10 SASI_Rn01_00064491 predicted 742
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_574943 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00126460 predicted 1800
2 SASI_Rn01_00126461 predicted 1783
3 SASI_Rn01_00126462 predicted 1356
4 SASI_Rn01_00126463 predicted 1381
5 SASI_Rn01_00126464 predicted 1769
6 SASI_Rn01_00126465 predicted 1338
7 SASI_Rn01_00126466 predicted 1094
8 SASI_Rn01_00126467 predicted 1589
9 SASI_Rn01_00126468 predicted 1576
10 SASI_Rn01_00126469 predicted 1162
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_007628 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00150643 predicted 380
2 SASI_Mm01_00150644 predicted 1216
3 SASI_Mm02_00312099 predicted 268
4 SASI_Mm01_00150646 predicted 435
5 SASI_Mm01_00150647 predicted 1224
6 SASI_Mm01_00150648 predicted 847
7 SASI_Mm01_00150649 predicted 376
8 SASI_Mm01_00150651 predicted 1186
9 SASI_Mm01_00150652 predicted 445
10 SASI_Mm02_00312100 predicted 1251
11 SASI_Mm01_00150645 predicted 278
12 SASI_Mm01_00150650 predicted 1221
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_003914
CCNA1 MISSION shRNA Bacterial Glycerol Stock
cyclin A1
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000435992    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003914.3-963s21c1
Sequence:CCGGGTGATAAATGTGACTGAATATCTCGAGATATTCAGTCACATTTATCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000421104    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003914.3-1613s21c1
Sequence:CCGGTTGCCTGAGTGAGCTTCATAACTCGAGTTATGAAGCTCACTCAGGCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000432957    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003914.3-653s21c1
Sequence:CCGGCACAAGAATCAGGTGTTATTCCTCGAGGAATAACACCTGATTCTTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000412276    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003914.3-1264s21c1
Sequence:CCGGCTCCTGAAGTAGACGAGTTTGCTCGAGCAAACTCGTCTACTTCAGGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000045188    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003914.2-1443s1c1
Sequence:CCGGGCAAGCAATTAGGGAGAAGTACTCGAGTACTTCTCCCTAATTGCTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000045189    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003914.2-1308s1c1
Sequence:CCGGCCTGGCAAACTATACTGTGAACTCGAGTTCACAGTATAGTTTGCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000045190    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003914.2-387s1c1
Sequence:CCGGGCTAACTGCAAATGGGCAGTACTCGAGTACTGCCCATTTGCAGTTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000045191    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003914.2-1018s1c1
Sequence:CCGGGCTTCGAAATATGAAGAGATACTCGAGTATCTCTTCATATTTCGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000045192    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003914.2-525s1c1
Sequence:CCGGGCAAGGGTTTGACATCTACATCTCGAGATGTAGATGTCAAACCCTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_003914
CCNA1 MISSION shRNA shRNA Plasmid DNA
cyclin A1
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000435992    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003914.3-963s21c1
Sequence:CCGGGTGATAAATGTGACTGAATATCTCGAGATATTCAGTCACATTTATCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000421104    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003914.3-1613s21c1
Sequence:CCGGTTGCCTGAGTGAGCTTCATAACTCGAGTTATGAAGCTCACTCAGGCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000432957    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003914.3-653s21c1
Sequence:CCGGCACAAGAATCAGGTGTTATTCCTCGAGGAATAACACCTGATTCTTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000412276    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003914.3-1264s21c1
Sequence:CCGGCTCCTGAAGTAGACGAGTTTGCTCGAGCAAACTCGTCTACTTCAGGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000045188    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003914.2-1443s1c1
Sequence:CCGGGCAAGCAATTAGGGAGAAGTACTCGAGTACTTCTCCCTAATTGCTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000045189    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003914.2-1308s1c1
Sequence:CCGGCCTGGCAAACTATACTGTGAACTCGAGTTCACAGTATAGTTTGCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000045190    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003914.2-387s1c1
Sequence:CCGGGCTAACTGCAAATGGGCAGTACTCGAGTACTGCCCATTTGCAGTTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000045191    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003914.2-1018s1c1
Sequence:CCGGGCTTCGAAATATGAAGAGATACTCGAGTATCTCTTCATATTTCGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000045192    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003914.2-525s1c1
Sequence:CCGGGCAAGGGTTTGACATCTACATCTCGAGATGTAGATGTCAAACCCTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_003914
CCNA1 MISSION shRNA Lentiviral Transduction Particles
cyclin A1
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000435992    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003914.3-963s21c1
Sequence:CCGGGTGATAAATGTGACTGAATATCTCGAGATATTCAGTCACATTTATCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000421104    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003914.3-1613s21c1
Sequence:CCGGTTGCCTGAGTGAGCTTCATAACTCGAGTTATGAAGCTCACTCAGGCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000432957    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003914.3-653s21c1
Sequence:CCGGCACAAGAATCAGGTGTTATTCCTCGAGGAATAACACCTGATTCTTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000412276    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003914.3-1264s21c1
Sequence:CCGGCTCCTGAAGTAGACGAGTTTGCTCGAGCAAACTCGTCTACTTCAGGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000045188    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003914.2-1443s1c1
Sequence:CCGGGCAAGCAATTAGGGAGAAGTACTCGAGTACTTCTCCCTAATTGCTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000045189    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003914.2-1308s1c1
Sequence:CCGGCCTGGCAAACTATACTGTGAACTCGAGTTCACAGTATAGTTTGCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000045190    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003914.2-387s1c1
Sequence:CCGGGCTAACTGCAAATGGGCAGTACTCGAGTACTGCCCATTTGCAGTTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000045191    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003914.2-1018s1c1
Sequence:CCGGGCTTCGAAATATGAAGAGATACTCGAGTATCTCTTCATATTTCGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000045192    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003914.2-525s1c1
Sequence:CCGGGCAAGGGTTTGACATCTACATCTCGAGATGTAGATGTCAAACCCTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_007628
CCNA1 MISSION shRNA Bacterial Glycerol Stock
cyclin A1
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000077758    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007628.1-969s1c1
Sequence:CCGGGCTACTCAAAGTCCTGGCATTCTCGAGAATGCCAGGACTTTGAGTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000077762    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007628.1-1047s1c1
Sequence:CCGGAGTGTGCATCAGGACTGAGAACTCGAGTTCTCAGTCCTGATGCACACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000077759    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007628.1-1105s1c1
Sequence:CCGGGCTGACCCGTTCTTGAAGTATCTCGAGATACTTCAAGAACGGGTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000077760    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007628.1-506s1c1
Sequence:CCGGTGCTGGATTTCAACACAGTTTCTCGAGAAACTGTGTTGAAATCCAGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000077761    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007628.1-1293s1c1
Sequence:CCGGGCAAGCAATCAGGGAGAAGTACTCGAGTACTTCTCCCTGATTGCTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_007628
CCNA1 MISSION shRNA shRNA Plasmid DNA
cyclin A1
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000077758    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007628.1-969s1c1
Sequence:CCGGGCTACTCAAAGTCCTGGCATTCTCGAGAATGCCAGGACTTTGAGTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000077762    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007628.1-1047s1c1
Sequence:CCGGAGTGTGCATCAGGACTGAGAACTCGAGTTCTCAGTCCTGATGCACACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000077759    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007628.1-1105s1c1
Sequence:CCGGGCTGACCCGTTCTTGAAGTATCTCGAGATACTTCAAGAACGGGTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000077760    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007628.1-506s1c1
Sequence:CCGGTGCTGGATTTCAACACAGTTTCTCGAGAAACTGTGTTGAAATCCAGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000077761    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007628.1-1293s1c1
Sequence:CCGGGCAAGCAATCAGGGAGAAGTACTCGAGTACTTCTCCCTGATTGCTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_007628
CCNA1 MISSION shRNA Lentiviral Transduction Particles
cyclin A1
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000077758    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007628.1-969s1c1
Sequence:CCGGGCTACTCAAAGTCCTGGCATTCTCGAGAATGCCAGGACTTTGAGTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000077762    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007628.1-1047s1c1
Sequence:CCGGAGTGTGCATCAGGACTGAGAACTCGAGTTCTCAGTCCTGATGCACACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000077759    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007628.1-1105s1c1
Sequence:CCGGGCTGACCCGTTCTTGAAGTATCTCGAGATACTTCAAGAACGGGTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000077760    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007628.1-506s1c1
Sequence:CCGGTGCTGGATTTCAACACAGTTTCTCGAGAAACTGTGTTGAAATCCAGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000077761    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007628.1-1293s1c1
Sequence:CCGGGCAAGCAATCAGGGAGAAGTACTCGAGTACTTCTCCCTGATTGCTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks