EMAIL THIS PAGE TO A FRIEND

CCNA2

cyclin A2

74 Gene Product Result for
Synonyms: CCN1 CCNA
UniProtKB ID: P20248, A8K7B6, Q2M3U6, Q4W5P4, Q6LER8
Gene ID:
Human(890) Summary: The protein encoded by this gene belongs to the highly conserved cyclin family, whose members are characterized by a dramatic periodicity in protein abundance through the cell cycle. Cyclins function as regulators of CDK kinases. Different cyclins exhibit distinct expression and degradation patterns which contribute to the temporal coordination of each mitotic event. In contrast to cyclin A1, which is present only in germ cells, this cyclin is expressed in all tissues tested. This cyclin binds and activates CDC2 or CDK2 kinases, and thus promotes both cell cycle G1/S and G2/M transitions. [provided by RefSeq, Jul 2008]
Mouse(12428) cyclin A2
Rat(114494) cyclin A2
sheep(100144758) cyclin A2
Zebrafish(192295) cyclin A2
cow(281667) cyclin A2
Horse(100072219) cyclin A2
chicken(396172) cyclin A2
dog(483845) cyclin A2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB1405570 Anti-CCNA2 antibody produced in mouse purified immunoglobulin, buffered aqueous solution human
immunofluorescence, western blot pricing
AV03045 Anti-CCNA2 antibody produced in rabbit IgG fraction of antiserum bovine, pig, rabbit, canine, human, zebrafish, mouse, rat, horse
western blot pricing
HPA020626 Anti-CCNA2 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunofluorescence, immunohistochemistry, western blot pricing
SAB2106206 Anti-CCNA2 antibody produced in rabbit affinity isolated antibody rabbit, rat, human, horse, guinea pig, sheep
ELISA, western blot pricing
C4710 Monoclonal Anti-Cyclin A antibody produced in mouse clone CY-A1, ascites fluid bovine, human, monkey, mouse
immunocytochemistry, microarray, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_009828 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_009828 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_009828 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_001237 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001237 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001237 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001237 siRNAs that have been validated in the lab human pricing
NM_053702 Rosetta Predictions rat pricing
NM_009828 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001237 siRNAs that have been validated in the lab Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00169103 validated 1271
2 SASI_Hs01_00169104 predicted 765
3 SASI_Hs01_00169105 predicted 919
4 SASI_Hs02_00331410 predicted 531
5 SASI_Hs01_00169106 predicted 808
6 SASI_Hs01_00169107 predicted 630
7 SASI_Hs01_00169108 predicted 1512
8 SASI_Hs01_00169109 predicted 907
9 SASI_Hs01_00169110 predicted 1414
10 SASI_Hs01_00169111 predicted 720
11 SASI_Hs01_00169112 predicted 1149
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_053702 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00088460 predicted 1197
2 SASI_Rn01_00088461 predicted 903
3 SASI_Rn01_00088462 predicted 527
4 SASI_Rn01_00088463 predicted 933
5 SASI_Rn01_00088464 predicted 675
6 SASI_Rn01_00088465 predicted 946
7 SASI_Rn01_00088466 predicted 747
8 SASI_Rn01_00088468 predicted 1368
9 SASI_Rn02_00266469 predicted 876
10 SASI_Rn02_00266470 predicted 1037
11 SASI_Rn01_00088459 predicted 1001
12 SASI_Rn01_00088467 predicted 964
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_009828 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00080755 predicted 702
2 SASI_Mm01_00080756 predicted 1292
3 SASI_Mm01_00080757 predicted 389
4 SASI_Mm01_00080758 predicted 608
5 SASI_Mm01_00080759 predicted 983
6 SASI_Mm01_00080760 predicted 1012
7 SASI_Mm01_00080761 predicted 1260
8 SASI_Mm01_00080762 predicted 1118
9 SASI_Mm01_00080763 predicted 1439
10 SASI_Mm01_00080764 predicted 1027
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_009828
CCNA2 MISSION shRNA Bacterial Glycerol Stock
cyclin A2
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000077763    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_009828.1-1617s1c1
Sequence:CCGGCCTGTCAAGATATTGAGAATACTCGAGTATTCTCAATATCTTGACAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000077767    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009828.1-890s1c1
Sequence:CCGGGCTTCGAAGTTTGAAGAAATACTCGAGTATTTCTTCAAACTTCGAAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000077764    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009828.1-626s1c1
Sequence:CCGGCCTGACTATCAAGAAGACATTCTCGAGAATGTCTTCTTGATAGTCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000077765    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009828.1-1314s1c1
Sequence:CCGGCCCAACAGTCAATACGGGAAACTCGAGTTTCCCGTATTGACTGTTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000077766    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009828.1-614s1c1
Sequence:CCGGGTTAATGAAGTACCTGACTATCTCGAGATAGTCAGGTACTTCATTAACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_009828
CCNA2 MISSION shRNA shRNA Plasmid DNA
cyclin A2
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000077763    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_009828.1-1617s1c1
Sequence:CCGGCCTGTCAAGATATTGAGAATACTCGAGTATTCTCAATATCTTGACAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000077767    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009828.1-890s1c1
Sequence:CCGGGCTTCGAAGTTTGAAGAAATACTCGAGTATTTCTTCAAACTTCGAAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000077764    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009828.1-626s1c1
Sequence:CCGGCCTGACTATCAAGAAGACATTCTCGAGAATGTCTTCTTGATAGTCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000077765    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009828.1-1314s1c1
Sequence:CCGGCCCAACAGTCAATACGGGAAACTCGAGTTTCCCGTATTGACTGTTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000077766    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009828.1-614s1c1
Sequence:CCGGGTTAATGAAGTACCTGACTATCTCGAGATAGTCAGGTACTTCATTAACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_009828
CCNA2 MISSION shRNA Lentiviral Transduction Particles
cyclin A2
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000077763    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_009828.1-1617s1c1
Sequence:CCGGCCTGTCAAGATATTGAGAATACTCGAGTATTCTCAATATCTTGACAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000077767    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009828.1-890s1c1
Sequence:CCGGGCTTCGAAGTTTGAAGAAATACTCGAGTATTTCTTCAAACTTCGAAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000077764    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009828.1-626s1c1
Sequence:CCGGCCTGACTATCAAGAAGACATTCTCGAGAATGTCTTCTTGATAGTCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000077765    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009828.1-1314s1c1
Sequence:CCGGCCCAACAGTCAATACGGGAAACTCGAGTTTCCCGTATTGACTGTTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000077766    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009828.1-614s1c1
Sequence:CCGGGTTAATGAAGTACCTGACTATCTCGAGATAGTCAGGTACTTCATTAACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001237
VALIDATED
CCNA2 MISSION shRNA Bacterial Glycerol Stock
cyclin A2
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000045287    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001237.2-1030s1c1
Sequence:CCGGGCTCCAACAGTAAATCAGTTTCTCGAGAAACTGATTTACTGTTGGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000045286    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001237.2-1224s1c1
Sequence:CCGGGCCTGAATCATTAATACGAAACTCGAGTTTCGTATTAATGATTCAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000045285    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 1 Clone ID:NM_001237.2-535s1c1
Sequence:CCGGCCTCTTGATTATCCAATGGATCTCGAGATCCATTGGATAATCAAGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000045284    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001237.2-663s1c1
Sequence:CCGGCCTTAGGGAAATGGAGGTTAACTCGAGTTAACCTCCATTTCCCTAAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000045283    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001237.2-1138s1c1
Sequence:CCGGGCTGACCCATACCTCAAGTATCTCGAGATACTTGAGGTATGGGTCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000293951    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001237.3-832s21c1
Sequence:CCGGCAGACTACCATGAGGATATTCCTCGAGGAATATCCTCATGGTAGTCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000293914    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001237.3-1448s21c1
Sequence:CCGGATATACCCTGGAAAGTCTTAACTCGAGTTAAGACTTTCCAGGGTATATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000293913    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 2 Clone ID:NM_001237.3-2013s21c1
Sequence:CCGGTCCTAAGCAACTGGATCAATTCTCGAGAATTGATCCAGTTGCTTAGGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000293912    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001237.3-1577s21c1
Sequence:CCGGCAACCCACCAGAGACACTAAACTCGAGTTTAGTGTCTCTGGTGGGTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000286479    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001237.3-732s21c1
Sequence:CCGGCCTCTTGATTATCCAATGGATCTCGAGATCCATTGGATAATCAAGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001237
VALIDATED
CCNA2 MISSION shRNA shRNA Plasmid DNA
cyclin A2
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000045287    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001237.2-1030s1c1
Sequence:CCGGGCTCCAACAGTAAATCAGTTTCTCGAGAAACTGATTTACTGTTGGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000045286    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001237.2-1224s1c1
Sequence:CCGGGCCTGAATCATTAATACGAAACTCGAGTTTCGTATTAATGATTCAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000045285    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 1 Clone ID:NM_001237.2-535s1c1
Sequence:CCGGCCTCTTGATTATCCAATGGATCTCGAGATCCATTGGATAATCAAGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000045284    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001237.2-663s1c1
Sequence:CCGGCCTTAGGGAAATGGAGGTTAACTCGAGTTAACCTCCATTTCCCTAAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000045283    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001237.2-1138s1c1
Sequence:CCGGGCTGACCCATACCTCAAGTATCTCGAGATACTTGAGGTATGGGTCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000293951    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001237.3-832s21c1
Sequence:CCGGCAGACTACCATGAGGATATTCCTCGAGGAATATCCTCATGGTAGTCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000293914    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001237.3-1448s21c1
Sequence:CCGGATATACCCTGGAAAGTCTTAACTCGAGTTAAGACTTTCCAGGGTATATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000293913    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 2 Clone ID:NM_001237.3-2013s21c1
Sequence:CCGGTCCTAAGCAACTGGATCAATTCTCGAGAATTGATCCAGTTGCTTAGGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000293912    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001237.3-1577s21c1
Sequence:CCGGCAACCCACCAGAGACACTAAACTCGAGTTTAGTGTCTCTGGTGGGTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000286479    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001237.3-732s21c1
Sequence:CCGGCCTCTTGATTATCCAATGGATCTCGAGATCCATTGGATAATCAAGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001237
VALIDATED
CCNA2 MISSION shRNA Lentiviral Transduction Particles
cyclin A2
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000045287    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001237.2-1030s1c1
Sequence:CCGGGCTCCAACAGTAAATCAGTTTCTCGAGAAACTGATTTACTGTTGGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000045286    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001237.2-1224s1c1
Sequence:CCGGGCCTGAATCATTAATACGAAACTCGAGTTTCGTATTAATGATTCAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000045285    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 1 Clone ID:NM_001237.2-535s1c1
Sequence:CCGGCCTCTTGATTATCCAATGGATCTCGAGATCCATTGGATAATCAAGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000045284    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001237.2-663s1c1
Sequence:CCGGCCTTAGGGAAATGGAGGTTAACTCGAGTTAACCTCCATTTCCCTAAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000045283    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001237.2-1138s1c1
Sequence:CCGGGCTGACCCATACCTCAAGTATCTCGAGATACTTGAGGTATGGGTCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000293951    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001237.3-832s21c1
Sequence:CCGGCAGACTACCATGAGGATATTCCTCGAGGAATATCCTCATGGTAGTCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000293914    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001237.3-1448s21c1
Sequence:CCGGATATACCCTGGAAAGTCTTAACTCGAGTTAAGACTTTCCAGGGTATATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000293913    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 2 Clone ID:NM_001237.3-2013s21c1
Sequence:CCGGTCCTAAGCAACTGGATCAATTCTCGAGAATTGATCCAGTTGCTTAGGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000293912    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001237.3-1577s21c1
Sequence:CCGGCAACCCACCAGAGACACTAAACTCGAGTTTAGTGTCTCTGGTGGGTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000286479    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001237.3-732s21c1
Sequence:CCGGCCTCTTGATTATCCAATGGATCTCGAGATCCATTGGATAATCAAGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)