EMAIL THIS PAGE TO A FRIEND

CCNB1

cyclin B1

82 Gene Product Result for
Synonyms: CCNB
UniProtKB ID: P14635
Gene ID:
Human(891) Summary: The protein encoded by this gene is a regulatory protein involved in mitosis. The gene product complexes with p34(cdc2) to form the maturation-promoting factor (MPF). Two alternative transcripts have been found, a constitutively expressed transcript and a cell cycle-regulated transcript, that is expressed predominantly during G2/M phase. The different transcripts result from the use of alternate transcription initiation sites. [provided by RefSeq, Jul 2008]
Mouse(268697) cyclin B1
Rat(25203) cyclin B1
Zebrafish(58025) cyclin B1
cow(327679) cyclin B1
dog(608420) cyclin B1
sheep(101120694) cyclin B1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB4300594 Anti-CCNB1 (Ab-147) antibody produced in rabbit affinity isolated antibody human
immunofluorescence, immunohistochemistry, western blot pricing
AV30161 Anti-CCNB1 antibody produced in rabbit affinity isolated antibody rat, mouse, horse, rabbit, human, canine, bovine, guinea pig
western blot pricing
SAB2100360 Anti-CCNB1 antibody produced in rabbit affinity isolated antibody mouse, pig, guinea pig, horse, rabbit, bovine, human, canine
western blot pricing
HPA030741 Anti-CCNB1 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody New human
immunofluorescence, western blot pricing
HPA061448 Anti-CCNB1 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody New human
immunofluorescence, immunohistochemistry, western blot pricing
SAB1306042 ANTI-CYCLIN B1 (S126) antibody produced in rabbit affinity isolated antibody, buffered aqueous solution human
western blot pricing
C8831 Anti-Cyclin B1 antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human, mouse, hamster
immunofluorescence, microarray, western blot pricing
SAB4503501 Anti-Cyclin B1 antibody produced in rabbit affinity isolated antibody human, mouse, rat
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
SAB4503502 Anti-Cyclin B1 antibody produced in rabbit affinity isolated antibody human, mouse, rat
ELISA, western blot pricing
SAB4300278 Anti-phospho-CCNB1 (pSer147) antibody produced in rabbit affinity isolated antibody human
immunofluorescence, immunohistochemistry, western blot pricing
SAB4503815 Anti-phospho-Cyclin B1 (pSer126) antibody produced in rabbit affinity isolated antibody mouse, human, rat
ELISA, immunohistochemistry, western blot pricing
SAB4504027 Anti-phospho-Cyclin B1 (pSer147) antibody produced in rabbit affinity isolated antibody mouse, human, rat
ELISA, immunohistochemistry, western blot pricing
WH0000891M1 Monoclonal Anti-CCNB1 antibody produced in mouse clone 1C8, purified immunoglobulin, buffered aqueous solution human
ELISA, immunohistochemistry, western blot pricing
SAB5300329 Monoclonal Anti-CCNB1 antibody produced in mouse clone 1B10, ascites fluid human
ELISA, immunohistochemistry, western blot pricing
SAB5300330 Monoclonal Anti-CCNB1 antibody produced in mouse clone 5G6, ascites fluid human, rat
ELISA, flow cytometry, immunofluorescence, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_172301 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_172301 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_172301 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_031966 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_031966 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_031966 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_031966 Rosetta Predictions human pricing
NM_171991 Rosetta Predictions rat pricing
NM_172301 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_031966 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00229215 predicted 926
2 SASI_Hs02_00359161 predicted 1144
3 SASI_Hs02_00359162 predicted 1277
4 SASI_Hs01_00229217 predicted 1015
5 SASI_Hs01_00229218 predicted 1153
6 SASI_Hs01_00229220 predicted 1426
7 SASI_Hs01_00229221 predicted 794
8 SASI_Hs01_00229222 predicted 311
9 SASI_Hs01_00229223 predicted 985
10 SASI_Hs01_00229224 predicted 1199
11 SASI_Hs01_00229216 predicted 666
12 SASI_Hs01_00229219 predicted 1344
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_171991 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00269084 predicted 297
2 SASI_Rn01_00077184 predicted 725
3 SASI_Rn01_00077185 predicted 231
4 SASI_Rn02_00269085 predicted 834
5 SASI_Rn02_00269086 predicted 1179
6 SASI_Rn01_00077188 predicted 1247
7 SASI_Rn01_00077190 predicted 580
8 SASI_Rn02_00269087 predicted 1032
9 SASI_Rn02_00269088 predicted 388
10 SASI_Rn01_00077192 predicted 446
11 SASI_Rn01_00077183 predicted 950
12 SASI_Rn01_00077186 predicted 1402
13 SASI_Rn01_00077187 predicted 1489
14 SASI_Rn01_00077189 predicted 1416
15 SASI_Rn01_00077191 predicted 621
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_172301 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00030893 predicted 699
2 SASI_Mm01_00030894 predicted 651
3 SASI_Mm01_00030895 predicted 1224
4 SASI_Mm02_00343791 predicted 1115
5 SASI_Mm02_00343792 predicted 689
6 SASI_Mm01_00030897 predicted 907
7 SASI_Mm02_00343793 predicted 1039
8 SASI_Mm01_00030901 predicted 338
9 SASI_Mm02_00343794 predicted 1175
10 SASI_Mm02_00343795 predicted 589
11 SASI_Mm01_00030896 predicted 491
12 SASI_Mm01_00030898 predicted 1373
13 SASI_Mm01_00030899 predicted 1375
14 SASI_Mm01_00030900 predicted 1445
15 SASI_Mm01_00030902 predicted 1334
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_172301
VALIDATED
CCNB1 MISSION shRNA Bacterial Glycerol Stock
cyclin B1
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000332715    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_172301.3-683s21c1
Sequence:CCGGCTATCCTCATTGACTGGCTAACTCGAGTTAGCCAGTCAATGAGGATAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000332638    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_172301.3-827s21c1
Sequence:CCGGCCATGTTTATTGCAAGCAAATCTCGAGATTTGCTTGCAATAAACATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000306521    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_172301.3-892s21c1
Sequence:CCGGACTAACAACACGTACACTAAGCTCGAGCTTAGTGTACGTGTTGTTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000306520    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_172301.3-745s21c1
Sequence:CCGGTACATGACTGTGTCCATTATTCTCGAGAATAATGGACACAGTCATGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000332716    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_172301.3-1445s21c1
Sequence:CCGGCGTGTTTACTTGCTCTTCAATCTCGAGATTGAAGAGCAAGTAAACACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000087923    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172301.2-1445s1c1
Sequence:CCGGCGTGTTTACTTGCTCTTCAATCTCGAGATTGAAGAGCAAGTAAACACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000087926    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172301.2-214s1c1
Sequence:CCGGGCTCTTGGAGACATTGGTAATCTCGAGATTACCAATGTCTCCAAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000087924    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172301.2-861s1c1
Sequence:CCGGCCCTCCAGAAATAGGTGACTTCTCGAGAAGTCACCTATTTCTGGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000087925    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172301.2-827s1c1
Sequence:CCGGCCATGTTTATTGCAAGCAAATCTCGAGATTTGCTTGCAATAAACATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_172301
VALIDATED
CCNB1 MISSION shRNA shRNA Plasmid DNA
cyclin B1
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000332715    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_172301.3-683s21c1
Sequence:CCGGCTATCCTCATTGACTGGCTAACTCGAGTTAGCCAGTCAATGAGGATAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000332638    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_172301.3-827s21c1
Sequence:CCGGCCATGTTTATTGCAAGCAAATCTCGAGATTTGCTTGCAATAAACATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000306521    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_172301.3-892s21c1
Sequence:CCGGACTAACAACACGTACACTAAGCTCGAGCTTAGTGTACGTGTTGTTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000306520    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_172301.3-745s21c1
Sequence:CCGGTACATGACTGTGTCCATTATTCTCGAGAATAATGGACACAGTCATGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000332716    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_172301.3-1445s21c1
Sequence:CCGGCGTGTTTACTTGCTCTTCAATCTCGAGATTGAAGAGCAAGTAAACACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000087923    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172301.2-1445s1c1
Sequence:CCGGCGTGTTTACTTGCTCTTCAATCTCGAGATTGAAGAGCAAGTAAACACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000087926    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172301.2-214s1c1
Sequence:CCGGGCTCTTGGAGACATTGGTAATCTCGAGATTACCAATGTCTCCAAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000087924    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172301.2-861s1c1
Sequence:CCGGCCCTCCAGAAATAGGTGACTTCTCGAGAAGTCACCTATTTCTGGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000087925    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172301.2-827s1c1
Sequence:CCGGCCATGTTTATTGCAAGCAAATCTCGAGATTTGCTTGCAATAAACATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_172301
VALIDATED
CCNB1 MISSION shRNA Lentiviral Transduction Particles
cyclin B1
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000332715    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_172301.3-683s21c1
Sequence:CCGGCTATCCTCATTGACTGGCTAACTCGAGTTAGCCAGTCAATGAGGATAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000332638    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_172301.3-827s21c1
Sequence:CCGGCCATGTTTATTGCAAGCAAATCTCGAGATTTGCTTGCAATAAACATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000306521    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_172301.3-892s21c1
Sequence:CCGGACTAACAACACGTACACTAAGCTCGAGCTTAGTGTACGTGTTGTTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000306520    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_172301.3-745s21c1
Sequence:CCGGTACATGACTGTGTCCATTATTCTCGAGAATAATGGACACAGTCATGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000332716    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_172301.3-1445s21c1
Sequence:CCGGCGTGTTTACTTGCTCTTCAATCTCGAGATTGAAGAGCAAGTAAACACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000087923    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172301.2-1445s1c1
Sequence:CCGGCGTGTTTACTTGCTCTTCAATCTCGAGATTGAAGAGCAAGTAAACACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000087926    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172301.2-214s1c1
Sequence:CCGGGCTCTTGGAGACATTGGTAATCTCGAGATTACCAATGTCTCCAAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000087924    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172301.2-861s1c1
Sequence:CCGGCCCTCCAGAAATAGGTGACTTCTCGAGAAGTCACCTATTTCTGGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000087925    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172301.2-827s1c1
Sequence:CCGGCCATGTTTATTGCAAGCAAATCTCGAGATTTGCTTGCAATAAACATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_031966
VALIDATED
CCNB1 MISSION shRNA Bacterial Glycerol Stock
cyclin B1
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000298625    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_031966.2-1260s21c1
Sequence:CCGGGACACCAACTCTACAACATTACTCGAGTAATGTTGTAGAGTTGGTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000286480    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031966.2-1144s21c1
Sequence:CCGGGCCAAATACCTGATGGAACTACTCGAGTAGTTCCATCAGGTATTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000293917    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.91 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_031966.2-1488s21c1
Sequence:CCGGCTTGAGTTGGAGTACTATATTCTCGAGAATATAGTACTCCAACTCAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000293916    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031966.2-994s21c1
Sequence:CCGGACTGACAACACTTATACTAAGCTCGAGCTTAGTATAAGTGTTGTCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000293915    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031966.2-847s21c1
Sequence:CCGGTACATGACTGTCTCCATTATTCTCGAGAATAATGGAGACAGTCATGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000045289    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031966.2-879s1c1
Sequence:CCGGGCAGAATAATTGTGTGCCCAACTCGAGTTGGGCACACAATTATTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000045291    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_031966.2-1144s1c1
Sequence:CCGGGCCAAATACCTGATGGAACTACTCGAGTAGTTCCATCAGGTATTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000045288    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_031966.2-1323s1c1
Sequence:CCGGCCTGGCTAAGAATGTAGTCATCTCGAGATGACTACATTCTTAGCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000045292    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031966.2-928s1c1
Sequence:CCGGGCCATGTTTATTGCAAGCAAACTCGAGTTTGCTTGCAATAAACATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000045290    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_031966.2-784s1c1
Sequence:CCGGGCCATCCTAATTGACTGGCTACTCGAGTAGCCAGTCAATTAGGATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_031966
VALIDATED
CCNB1 MISSION shRNA shRNA Plasmid DNA
cyclin B1
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000298625    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_031966.2-1260s21c1
Sequence:CCGGGACACCAACTCTACAACATTACTCGAGTAATGTTGTAGAGTTGGTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000286480    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031966.2-1144s21c1
Sequence:CCGGGCCAAATACCTGATGGAACTACTCGAGTAGTTCCATCAGGTATTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000293917    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.91 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_031966.2-1488s21c1
Sequence:CCGGCTTGAGTTGGAGTACTATATTCTCGAGAATATAGTACTCCAACTCAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000293916    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031966.2-994s21c1
Sequence:CCGGACTGACAACACTTATACTAAGCTCGAGCTTAGTATAAGTGTTGTCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000293915    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031966.2-847s21c1
Sequence:CCGGTACATGACTGTCTCCATTATTCTCGAGAATAATGGAGACAGTCATGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000045289    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031966.2-879s1c1
Sequence:CCGGGCAGAATAATTGTGTGCCCAACTCGAGTTGGGCACACAATTATTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000045291    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_031966.2-1144s1c1
Sequence:CCGGGCCAAATACCTGATGGAACTACTCGAGTAGTTCCATCAGGTATTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000045288    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_031966.2-1323s1c1
Sequence:CCGGCCTGGCTAAGAATGTAGTCATCTCGAGATGACTACATTCTTAGCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000045292    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031966.2-928s1c1
Sequence:CCGGGCCATGTTTATTGCAAGCAAACTCGAGTTTGCTTGCAATAAACATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000045290    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_031966.2-784s1c1
Sequence:CCGGGCCATCCTAATTGACTGGCTACTCGAGTAGCCAGTCAATTAGGATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_031966
VALIDATED
CCNB1 MISSION shRNA Lentiviral Transduction Particles
cyclin B1
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000298625    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_031966.2-1260s21c1
Sequence:CCGGGACACCAACTCTACAACATTACTCGAGTAATGTTGTAGAGTTGGTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000286480    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031966.2-1144s21c1
Sequence:CCGGGCCAAATACCTGATGGAACTACTCGAGTAGTTCCATCAGGTATTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000293917    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.91 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_031966.2-1488s21c1
Sequence:CCGGCTTGAGTTGGAGTACTATATTCTCGAGAATATAGTACTCCAACTCAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000293916    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031966.2-994s21c1
Sequence:CCGGACTGACAACACTTATACTAAGCTCGAGCTTAGTATAAGTGTTGTCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000293915    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031966.2-847s21c1
Sequence:CCGGTACATGACTGTCTCCATTATTCTCGAGAATAATGGAGACAGTCATGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000045289    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031966.2-879s1c1
Sequence:CCGGGCAGAATAATTGTGTGCCCAACTCGAGTTGGGCACACAATTATTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000045291    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_031966.2-1144s1c1
Sequence:CCGGGCCAAATACCTGATGGAACTACTCGAGTAGTTCCATCAGGTATTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000045288    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_031966.2-1323s1c1
Sequence:CCGGCCTGGCTAAGAATGTAGTCATCTCGAGATGACTACATTCTTAGCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000045292    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031966.2-928s1c1
Sequence:CCGGGCCATGTTTATTGCAAGCAAACTCGAGTTTGCTTGCAATAAACATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000045290    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_031966.2-784s1c1
Sequence:CCGGGCCATCCTAATTGACTGGCTACTCGAGTAGCCAGTCAATTAGGATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks