EMAIL THIS PAGE TO A FRIEND

CCNB1IP1

cyclin B1 interacting protein 1, E3 ubiquitin protein ligase

104 Gene Product Result for
Synonyms: C14orf18 HEI10
UniProtKB ID: Q9NPC3
Gene ID:
Human(57820) Summary: HEI10 is a member of the E3 ubiquitin ligase family and functions in progression of the cell cycle through G(2)/M.[supplied by OMIM, Apr 2004]
Mouse(239083) cyclin B1 interacting protein 1
Rat(498492) cyclin B1 interacting protein 1, E3 ubiquitin protein ligase
sheep(101115966) cyclin B1 interacting protein 1, E3 ubiquitin protein ligase
domestic guinea pig(100719895) cyclin B1 interacting protein 1, E3 ubiquitin protein ligase
naked mole-rat(101712347) cyclin B1 interacting protein 1, E3 ubiquitin protein ligase
dog(482554) cyclin B1 interacting protein 1, E3 ubiquitin protein ligase
domestic cat(101100569) cyclin B1 interacting protein 1, E3 ubiquitin protein ligase
cow(615932) cyclin B1 interacting protein 1, E3 ubiquitin protein ligase
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_021178 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_021178 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_021178 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001111119 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001111119 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001111119 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_021178 Rosetta Predictions human pricing
NM_182849 Rosetta Predictions human pricing
NM_182851 Rosetta Predictions human pricing
NM_182852 Rosetta Predictions human pricing
NM_001025141 Rosetta Predictions rat pricing
NM_001111119 Rosetta Predictions mouse pricing
XM_139038 Rosetta Predictions mouse pricing
XM_907202 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_021178 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00133950 predicted 1012
2 SASI_Hs01_00133951 predicted 711
3 SASI_Hs01_00133952 predicted 787
4 SASI_Hs02_00354744 predicted 938
5 SASI_Hs01_00133953 predicted 712
6 SASI_Hs02_00354745 predicted 870
7 SASI_Hs01_00133954 predicted 1022
8 SASI_Hs01_00133955 predicted 774
9 SASI_Hs01_00133956 predicted 968
10 SASI_Hs01_00133957 predicted 644
11 SASI_Hs01_00133958 predicted 874
12 SASI_Hs01_00133959 predicted 1032
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_182849 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00033969 predicted 810
2 SASI_Hs01_00033970 predicted 516
3 SASI_Hs01_00033971 predicted 583
4 SASI_Hs02_00370982 predicted 744
5 SASI_Hs01_00033972 predicted 513
6 SASI_Hs02_00370983 predicted 664
7 SASI_Hs01_00033973 predicted 816
8 SASI_Hs01_00033974 predicted 572
9 SASI_Hs01_00033975 predicted 767
10 SASI_Hs01_00033976 predicted 439
11 SASI_Hs01_00033977 predicted 671
12 SASI_Hs01_00033978 predicted 834
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_182851 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00097608 predicted 1184
2 SASI_Hs01_00097609 predicted 889
3 SASI_Hs01_00097610 predicted 953
4 SASI_Hs02_00370984 predicted 1115
5 SASI_Hs01_00097611 predicted 883
6 SASI_Hs02_00370985 predicted 1036
7 SASI_Hs01_00097612 predicted 1194
8 SASI_Hs01_00097613 predicted 951
9 SASI_Hs01_00097614 predicted 1140
10 SASI_Hs01_00097615 predicted 820
11 SASI_Hs01_00097616 predicted 1046
12 SASI_Hs01_00097617 predicted 1206
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_182852 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00048300 predicted 1150
2 SASI_Hs01_00048301 predicted 851
3 SASI_Hs01_00048302 predicted 922
4 SASI_Hs02_00370986 predicted 1089
5 SASI_Hs01_00048303 predicted 858
6 SASI_Hs02_00370987 predicted 1004
7 SASI_Hs01_00048304 predicted 1167
8 SASI_Hs01_00048305 predicted 923
9 SASI_Hs01_00048306 predicted 1113
10 SASI_Hs01_00048307 predicted 781
11 SASI_Hs01_00048308 predicted 1021
12 SASI_Hs01_00048309 predicted 1176
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001025141 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00073555 predicted 808
2 SASI_Rn01_00073556 predicted 1100
3 SASI_Rn01_00073557 predicted 862
4 SASI_Rn01_00073558 predicted 455
5 SASI_Rn01_00073559 predicted 779
6 SASI_Rn01_00073560 predicted 454
7 SASI_Rn01_00073561 predicted 832
8 SASI_Rn01_00073562 predicted 438
9 SASI_Rn01_00073563 predicted 876
10 SASI_Rn01_00073564 predicted 543
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001111119 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00306482 predicted 797
2 SASI_Mm02_00306483 predicted 609
3 SASI_Mm02_00306484 predicted 418
4 SASI_Mm02_00306485 predicted 286
5 SASI_Mm02_00306486 predicted 416
6 SASI_Mm02_00306487 predicted 764
7 SASI_Mm02_00306488 predicted 606
8 SASI_Mm02_00306489 predicted 469
9 SASI_Mm02_00306490 predicted 766
10 SASI_Mm02_00306491 predicted 531
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_139038 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00246673 predicted 1194
2 SASI_Mm01_00246674 predicted 1188
3 SASI_Mm01_00246675 predicted 1187
4 SASI_Mm01_00246676 predicted 1205
5 SASI_Mm01_00246677 predicted 1189
6 SASI_Mm01_00246678 predicted 1178
7 SASI_Mm01_00246679 predicted 1192
8 SASI_Mm01_00246680 predicted 1175
9 SASI_Mm01_00246681 predicted 1191
10 SASI_Mm01_00246682 predicted 1189
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_907202 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00433149 predicted 803
2 SASI_Mm02_00433150 predicted 606
3 SASI_Mm02_00433151 predicted 422
4 SASI_Mm02_00433152 predicted 283
5 SASI_Mm02_00433153 predicted 414
6 SASI_Mm02_00433154 predicted 767
7 SASI_Mm02_00433155 predicted 604
8 SASI_Mm02_00433156 predicted 469
9 SASI_Mm02_00433157 predicted 766
10 SASI_Mm02_00433158 predicted 527
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_021178
VALIDATED
CCNB1IP1 MISSION shRNA Bacterial Glycerol Stock
cyclin B1 interacting protein 1, E3 ubiquitin protein ligase
Human
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000003418    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_021178.x-1017s1c1
Sequence:CCGGAGGCTACGAAACATCACTATTCTCGAGAATAGTGATGTTTCGTAGCCTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000003419    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_021178.x-957s1c1
Sequence:CCGGGAGAAACTTATGGAGCGCAATCTCGAGATTGCGCTCCATAAGTTTCTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000003420    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021178.x-468s1c1
Sequence:CCGGCCTATTATGTCTTTGTGTGAACTCGAGTTCACACAAAGACATAATAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000003421    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021178.x-1122s1c1
Sequence:CCGGCCTTTGGATAATACACCTGTTCTCGAGAACAGGTGTATTATCCAAAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000003422    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_021178.x-1382s1c1
Sequence:CCGGGAGTCTGAGGCTTTAGTGATCCTCGAGGATCACTAAAGCCTCAGACTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000418814    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021178.3-579s21c1
Sequence:CCGGAGCATGGCAGTGGTGAGTTTACTCGAGTAAACTCACCACTGCCATGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000314781    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021178.3-1318s21c1
Sequence:CCGGTAGTGTCACGCACCTGTGATCCTCGAGGATCACAGGTGCGTGACACTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000314779    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021178.3-1241s21c1
Sequence:CCGGGTCTCTCCAAGTCGTGAATTACTCGAGTAATTCACGACTTGGAGAGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000369084    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021178.3-510s21c1
Sequence:CCGGATCGAAAGTGTCGCATCAAACCTCGAGGTTTGATGCGACACTTTCGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000314834    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021178.3-1130s21c1
Sequence:CCGGGATAATACACCTGTTCGAAATCTCGAGATTTCGAACAGGTGTATTATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000314835    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021178.3-781s21c1
Sequence:CCGGGGAACGTCTCTATCAAGAATACTCGAGTATTCTTGATAGAGACGTTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000369083    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021178.3-685s21c1
Sequence:CCGGGGAATATAAAGCTATGGTATTCTCGAGAATACCATAGCTTTATATTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_021178
VALIDATED
CCNB1IP1 MISSION shRNA shRNA Plasmid DNA
cyclin B1 interacting protein 1, E3 ubiquitin protein ligase
Human
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000003418    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_021178.x-1017s1c1
Sequence:CCGGAGGCTACGAAACATCACTATTCTCGAGAATAGTGATGTTTCGTAGCCTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000003419    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_021178.x-957s1c1
Sequence:CCGGGAGAAACTTATGGAGCGCAATCTCGAGATTGCGCTCCATAAGTTTCTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000003420    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021178.x-468s1c1
Sequence:CCGGCCTATTATGTCTTTGTGTGAACTCGAGTTCACACAAAGACATAATAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000003421    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021178.x-1122s1c1
Sequence:CCGGCCTTTGGATAATACACCTGTTCTCGAGAACAGGTGTATTATCCAAAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000003422    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_021178.x-1382s1c1
Sequence:CCGGGAGTCTGAGGCTTTAGTGATCCTCGAGGATCACTAAAGCCTCAGACTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000418814    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021178.3-579s21c1
Sequence:CCGGAGCATGGCAGTGGTGAGTTTACTCGAGTAAACTCACCACTGCCATGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000314781    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021178.3-1318s21c1
Sequence:CCGGTAGTGTCACGCACCTGTGATCCTCGAGGATCACAGGTGCGTGACACTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000314779    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021178.3-1241s21c1
Sequence:CCGGGTCTCTCCAAGTCGTGAATTACTCGAGTAATTCACGACTTGGAGAGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000369084    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021178.3-510s21c1
Sequence:CCGGATCGAAAGTGTCGCATCAAACCTCGAGGTTTGATGCGACACTTTCGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000314834    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021178.3-1130s21c1
Sequence:CCGGGATAATACACCTGTTCGAAATCTCGAGATTTCGAACAGGTGTATTATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000314835    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021178.3-781s21c1
Sequence:CCGGGGAACGTCTCTATCAAGAATACTCGAGTATTCTTGATAGAGACGTTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000369083    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021178.3-685s21c1
Sequence:CCGGGGAATATAAAGCTATGGTATTCTCGAGAATACCATAGCTTTATATTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_021178
VALIDATED
CCNB1IP1 MISSION shRNA Lentiviral Transduction Particles
cyclin B1 interacting protein 1, E3 ubiquitin protein ligase
Human
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000003418    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_021178.x-1017s1c1
Sequence:CCGGAGGCTACGAAACATCACTATTCTCGAGAATAGTGATGTTTCGTAGCCTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000003419    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_021178.x-957s1c1
Sequence:CCGGGAGAAACTTATGGAGCGCAATCTCGAGATTGCGCTCCATAAGTTTCTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000003420    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021178.x-468s1c1
Sequence:CCGGCCTATTATGTCTTTGTGTGAACTCGAGTTCACACAAAGACATAATAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000003421    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021178.x-1122s1c1
Sequence:CCGGCCTTTGGATAATACACCTGTTCTCGAGAACAGGTGTATTATCCAAAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000003422    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_021178.x-1382s1c1
Sequence:CCGGGAGTCTGAGGCTTTAGTGATCCTCGAGGATCACTAAAGCCTCAGACTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000418814    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021178.3-579s21c1
Sequence:CCGGAGCATGGCAGTGGTGAGTTTACTCGAGTAAACTCACCACTGCCATGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000314781    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021178.3-1318s21c1
Sequence:CCGGTAGTGTCACGCACCTGTGATCCTCGAGGATCACAGGTGCGTGACACTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000314779    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021178.3-1241s21c1
Sequence:CCGGGTCTCTCCAAGTCGTGAATTACTCGAGTAATTCACGACTTGGAGAGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000369084    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021178.3-510s21c1
Sequence:CCGGATCGAAAGTGTCGCATCAAACCTCGAGGTTTGATGCGACACTTTCGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000314834    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021178.3-1130s21c1
Sequence:CCGGGATAATACACCTGTTCGAAATCTCGAGATTTCGAACAGGTGTATTATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000314835    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021178.3-781s21c1
Sequence:CCGGGGAACGTCTCTATCAAGAATACTCGAGTATTCTTGATAGAGACGTTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000369083    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021178.3-685s21c1
Sequence:CCGGGGAATATAAAGCTATGGTATTCTCGAGAATACCATAGCTTTATATTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001111119
CCNB1IP1 MISSION shRNA Bacterial Glycerol Stock
cyclin B1 interacting protein 1, E3 ubiquitin protein ligase
Mouse
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000258135    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001111119.1-1191s21c1
Sequence:CCGGGGATTGATTCTACCGTGTTTACTCGAGTAAACACGGTAGAATCAATCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000251122    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001111119.1-313s21c1
Sequence:CCGGGTCCATCAGAGGAGTACAAAGCTCGAGCTTTGTACTCCTCTGATGGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000251121    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001111119.1-421s21c1
Sequence:CCGGAGCGTCTCTATCAAGAGTATACTCGAGTATACTCTTGATAGAGACGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000267401    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001111119.1-843s21c1
Sequence:CCGGACAGCGCCTGAACCCATTAACCTCGAGGTTAATGGGTTCAGGCGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001111119
CCNB1IP1 MISSION shRNA shRNA Plasmid DNA
cyclin B1 interacting protein 1, E3 ubiquitin protein ligase
Mouse
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000258135    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001111119.1-1191s21c1
Sequence:CCGGGGATTGATTCTACCGTGTTTACTCGAGTAAACACGGTAGAATCAATCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000251122    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001111119.1-313s21c1
Sequence:CCGGGTCCATCAGAGGAGTACAAAGCTCGAGCTTTGTACTCCTCTGATGGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000251121    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001111119.1-421s21c1
Sequence:CCGGAGCGTCTCTATCAAGAGTATACTCGAGTATACTCTTGATAGAGACGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000267401    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001111119.1-843s21c1
Sequence:CCGGACAGCGCCTGAACCCATTAACCTCGAGGTTAATGGGTTCAGGCGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001111119
CCNB1IP1 MISSION shRNA Lentiviral Transduction Particles
cyclin B1 interacting protein 1, E3 ubiquitin protein ligase
Mouse
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000258135    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001111119.1-1191s21c1
Sequence:CCGGGGATTGATTCTACCGTGTTTACTCGAGTAAACACGGTAGAATCAATCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000251122    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001111119.1-313s21c1
Sequence:CCGGGTCCATCAGAGGAGTACAAAGCTCGAGCTTTGTACTCCTCTGATGGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000251121    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001111119.1-421s21c1
Sequence:CCGGAGCGTCTCTATCAAGAGTATACTCGAGTATACTCTTGATAGAGACGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000267401    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001111119.1-843s21c1
Sequence:CCGGACAGCGCCTGAACCCATTAACCTCGAGGTTAATGGGTTCAGGCGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks