EMAIL THIS PAGE TO A FRIEND

CCNB2

cyclin B2

54 Gene Product Result for
Synonyms: HsT17299
UniProtKB ID: O95067, B3KM93, Q6FI99
Gene ID:
Human(9133) Summary: Cyclin B2 is a member of the cyclin family, specifically the B-type cyclins. The B-type cyclins, B1 and B2, associate with p34cdc2 and are essential components of the cell cycle regulatory machinery. B1 and B2 differ in their subcellular localization. Cyclin B1 co-localizes with microtubules, whereas cyclin B2 is primarily associated with the Golgi region. Cyclin B2 also binds to transforming growth factor beta RII and thus cyclin B2/cdc2 may play a key role in transforming growth factor beta-mediated cell cycle control. [provided by RefSeq, Jul 2008]
Mouse(12442) cyclin B2
Rat(363088) cyclin B2
Zebrafish(368316) cyclin B2
chicken(415400) cyclin B2
Horse(100054413) cyclin B2
cow(281668) cyclin B2
dog(478324) cyclin B2
sheep(101115712) cyclin B2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_007630 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_007630 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_007630 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_004701 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_004701 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_004701 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_004701 Rosetta Predictions human pricing
NM_001009470 Rosetta Predictions rat pricing
NM_007630 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004701 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00172103 predicted 761
2 SASI_Hs01_00172104 predicted 703
3 SASI_Hs01_00172105 predicted 870
4 SASI_Hs01_00172106 predicted 806
5 SASI_Hs01_00172107 predicted 765
6 SASI_Hs01_00172108 predicted 1275
7 SASI_Hs01_00172109 predicted 355
8 SASI_Hs01_00172110 predicted 777
9 SASI_Hs01_00172111 predicted 676
10 SASI_Hs01_00172112 predicted 493
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001009470 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00199549 predicted 865
2 SASI_Rn01_00050644 predicted 782
3 SASI_Rn01_00050645 predicted 1105
4 SASI_Rn01_00050646 predicted 517
5 SASI_Rn01_00050647 predicted 409
6 SASI_Rn01_00050648 predicted 1059
7 SASI_Rn01_00050650 predicted 211
8 SASI_Rn01_00050651 predicted 515
9 SASI_Rn02_00199550 predicted 598
10 SASI_Rn01_00050652 predicted 206
11 SASI_Rn01_00050649 predicted 520
12 SASI_Rn01_00050653 predicted 389
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_007630 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00187806 predicted 665
2 SASI_Mm02_00312101 predicted 808
3 SASI_Mm02_00312102 predicted 501
4 SASI_Mm02_00312103 predicted 1079
5 SASI_Mm01_00187808 predicted 1181
6 SASI_Mm01_00187809 predicted 847
7 SASI_Mm01_00187810 predicted 826
8 SASI_Mm01_00187811 predicted 1053
9 SASI_Mm01_00187812 predicted 553
10 SASI_Mm01_00187814 predicted 641
11 SASI_Mm01_00187807 predicted 1090
12 SASI_Mm01_00187813 predicted 950
13 SASI_Mm01_00187815 predicted 903
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_007630
VALIDATED
CCNB2 MISSION shRNA Bacterial Glycerol Stock
cyclin B2
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000317464    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007630.2-1332s21c1
Sequence:CCGGGCTTCTCAGATCCTGTATGTACTCGAGTACATACAGGATCTGAGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000317396    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007630.2-1098s21c1
Sequence:CCGGGCAGCAGTATTACACAGGCTACTCGAGTAGCCTGTGTAATACTGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000317395    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007630.2-952s21c1
Sequence:CCGGGATGTTGAACAGCACACTTTACTCGAGTAAAGTGTGCTGTTCAACATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000317394    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007630.2-454s21c1
Sequence:CCGGCTCTGCAAGATCGAGGACATACTCGAGTATGTCCTCGATCTTGCAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000077768    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007630.1-1319s1c1
Sequence:CCGGGCTTCTCAGATCCTGTATGTACTCGAGTACATACAGGATCTGAGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000077770    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_007630.1-1085s1c1
Sequence:CCGGGCAGCAGTATTACACAGGCTACTCGAGTAGCCTGTGTAATACTGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000077772    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007630.1-574s1c1
Sequence:CCGGGAAGAGATATAAATGGACGTACTCGAGTACGTCCATTTATATCTCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000077771    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_007630.1-939s1c1
Sequence:CCGGGATGTTGAACAGCACACTTTACTCGAGTAAAGTGTGCTGTTCAACATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000077769    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_007630.1-441s1c1
Sequence:CCGGCTCTGCAAGATCGAGGACATACTCGAGTATGTCCTCGATCTTGCAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_007630
VALIDATED
CCNB2 MISSION shRNA shRNA Plasmid DNA
cyclin B2
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000317464    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007630.2-1332s21c1
Sequence:CCGGGCTTCTCAGATCCTGTATGTACTCGAGTACATACAGGATCTGAGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000317396    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007630.2-1098s21c1
Sequence:CCGGGCAGCAGTATTACACAGGCTACTCGAGTAGCCTGTGTAATACTGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000317395    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007630.2-952s21c1
Sequence:CCGGGATGTTGAACAGCACACTTTACTCGAGTAAAGTGTGCTGTTCAACATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000317394    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007630.2-454s21c1
Sequence:CCGGCTCTGCAAGATCGAGGACATACTCGAGTATGTCCTCGATCTTGCAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000077768    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007630.1-1319s1c1
Sequence:CCGGGCTTCTCAGATCCTGTATGTACTCGAGTACATACAGGATCTGAGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000077770    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_007630.1-1085s1c1
Sequence:CCGGGCAGCAGTATTACACAGGCTACTCGAGTAGCCTGTGTAATACTGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000077772    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007630.1-574s1c1
Sequence:CCGGGAAGAGATATAAATGGACGTACTCGAGTACGTCCATTTATATCTCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000077771    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_007630.1-939s1c1
Sequence:CCGGGATGTTGAACAGCACACTTTACTCGAGTAAAGTGTGCTGTTCAACATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000077769    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_007630.1-441s1c1
Sequence:CCGGCTCTGCAAGATCGAGGACATACTCGAGTATGTCCTCGATCTTGCAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_007630
VALIDATED
CCNB2 MISSION shRNA Lentiviral Transduction Particles
cyclin B2
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000317464    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007630.2-1332s21c1
Sequence:CCGGGCTTCTCAGATCCTGTATGTACTCGAGTACATACAGGATCTGAGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000317396    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007630.2-1098s21c1
Sequence:CCGGGCAGCAGTATTACACAGGCTACTCGAGTAGCCTGTGTAATACTGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000317395    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007630.2-952s21c1
Sequence:CCGGGATGTTGAACAGCACACTTTACTCGAGTAAAGTGTGCTGTTCAACATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000317394    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007630.2-454s21c1
Sequence:CCGGCTCTGCAAGATCGAGGACATACTCGAGTATGTCCTCGATCTTGCAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000077768    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007630.1-1319s1c1
Sequence:CCGGGCTTCTCAGATCCTGTATGTACTCGAGTACATACAGGATCTGAGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000077770    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_007630.1-1085s1c1
Sequence:CCGGGCAGCAGTATTACACAGGCTACTCGAGTAGCCTGTGTAATACTGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000077772    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007630.1-574s1c1
Sequence:CCGGGAAGAGATATAAATGGACGTACTCGAGTACGTCCATTTATATCTCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000077771    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_007630.1-939s1c1
Sequence:CCGGGATGTTGAACAGCACACTTTACTCGAGTAAAGTGTGCTGTTCAACATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000077769    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_007630.1-441s1c1
Sequence:CCGGCTCTGCAAGATCGAGGACATACTCGAGTATGTCCTCGATCTTGCAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_004701
VALIDATED
CCNB2 MISSION shRNA Bacterial Glycerol Stock
cyclin B2
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000288767    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004701.2-1036s21c1
Sequence:CCGGCGACTATGATATGGTGCATTACTCGAGTAATGCACCATATCATAGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000288765    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004701.2-1190s21c1
Sequence:CCGGGCCAAGAATGTGGTGAAAGTACTCGAGTACTTTCACCACATTCTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000288837    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004701.2-1132s21c1
Sequence:CCGGGCAGCAGTATTACACAGGATACTCGAGTATCCTGTGTAATACTGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000288836    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004701.2-592s21c1
Sequence:CCGGGCAGTCCATAAACCCACATTTCTCGAGAAATGTGGGTTTATGGACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000306811    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004701.2-1367s21c1
Sequence:CCGGGTGTGCTTCATTGTGCCCTTTCTCGAGAAAGGGCACAATGAAGCACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000045194    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004701.2-1036s1c1
Sequence:CCGGCGACTATGATATGGTGCATTACTCGAGTAATGCACCATATCATAGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000045193    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1 Clone ID:NM_004701.2-1367s1c1
Sequence:CCGGGTGTGCTTCATTGTGCCCTTTCTCGAGAAAGGGCACAATGAAGCACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000045197    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_004701.2-1190s1c1
Sequence:CCGGGCCAAGAATGTGGTGAAAGTACTCGAGTACTTTCACCACATTCTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000045195    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004701.2-1132s1c1
Sequence:CCGGGCAGCAGTATTACACAGGATACTCGAGTATCCTGTGTAATACTGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000045196    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 1 Clone ID:NM_004701.2-592s1c1
Sequence:CCGGGCAGTCCATAAACCCACATTTCTCGAGAAATGTGGGTTTATGGACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_004701
VALIDATED
CCNB2 MISSION shRNA shRNA Plasmid DNA
cyclin B2
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000288767    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004701.2-1036s21c1
Sequence:CCGGCGACTATGATATGGTGCATTACTCGAGTAATGCACCATATCATAGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000288765    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004701.2-1190s21c1
Sequence:CCGGGCCAAGAATGTGGTGAAAGTACTCGAGTACTTTCACCACATTCTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000288837    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004701.2-1132s21c1
Sequence:CCGGGCAGCAGTATTACACAGGATACTCGAGTATCCTGTGTAATACTGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000288836    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004701.2-592s21c1
Sequence:CCGGGCAGTCCATAAACCCACATTTCTCGAGAAATGTGGGTTTATGGACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000306811    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004701.2-1367s21c1
Sequence:CCGGGTGTGCTTCATTGTGCCCTTTCTCGAGAAAGGGCACAATGAAGCACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000045194    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004701.2-1036s1c1
Sequence:CCGGCGACTATGATATGGTGCATTACTCGAGTAATGCACCATATCATAGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000045193    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1 Clone ID:NM_004701.2-1367s1c1
Sequence:CCGGGTGTGCTTCATTGTGCCCTTTCTCGAGAAAGGGCACAATGAAGCACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000045197    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_004701.2-1190s1c1
Sequence:CCGGGCCAAGAATGTGGTGAAAGTACTCGAGTACTTTCACCACATTCTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000045195    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004701.2-1132s1c1
Sequence:CCGGGCAGCAGTATTACACAGGATACTCGAGTATCCTGTGTAATACTGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000045196    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 1 Clone ID:NM_004701.2-592s1c1
Sequence:CCGGGCAGTCCATAAACCCACATTTCTCGAGAAATGTGGGTTTATGGACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_004701
VALIDATED
CCNB2 MISSION shRNA Lentiviral Transduction Particles
cyclin B2
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000288767    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004701.2-1036s21c1
Sequence:CCGGCGACTATGATATGGTGCATTACTCGAGTAATGCACCATATCATAGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000288765    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004701.2-1190s21c1
Sequence:CCGGGCCAAGAATGTGGTGAAAGTACTCGAGTACTTTCACCACATTCTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000288837    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004701.2-1132s21c1
Sequence:CCGGGCAGCAGTATTACACAGGATACTCGAGTATCCTGTGTAATACTGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000288836    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004701.2-592s21c1
Sequence:CCGGGCAGTCCATAAACCCACATTTCTCGAGAAATGTGGGTTTATGGACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000306811    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004701.2-1367s21c1
Sequence:CCGGGTGTGCTTCATTGTGCCCTTTCTCGAGAAAGGGCACAATGAAGCACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000045194    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004701.2-1036s1c1
Sequence:CCGGCGACTATGATATGGTGCATTACTCGAGTAATGCACCATATCATAGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000045193    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1 Clone ID:NM_004701.2-1367s1c1
Sequence:CCGGGTGTGCTTCATTGTGCCCTTTCTCGAGAAAGGGCACAATGAAGCACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000045197    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_004701.2-1190s1c1
Sequence:CCGGGCCAAGAATGTGGTGAAAGTACTCGAGTACTTTCACCACATTCTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000045195    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004701.2-1132s1c1
Sequence:CCGGGCAGCAGTATTACACAGGATACTCGAGTATCCTGTGTAATACTGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000045196    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 1 Clone ID:NM_004701.2-592s1c1
Sequence:CCGGGCAGTCCATAAACCCACATTTCTCGAGAAATGTGGGTTTATGGACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks