EMAIL THIS PAGE TO A FRIEND

CCNB3

cyclin B3

79 Gene Product Result for
Gene ID:
Human(85417) Summary: The protein encoded by this gene belongs to the highly conserved cyclin family, whose members are characterized by a dramatic periodicity in protein abundance through the cell cycle. Cyclins function as positive regulators of cyclin-dependent kinases (CDKs), and thereby play an essential role in the control of the cell cycle. Different cyclins exhibit distinct expression and degradation patterns, which contribute to the temporal coordination of each mitotic event. Studies of similar genes in chicken and drosophila suggest that this cyclin may associate with CDC2 and CDK2 kinases, and may be required for proper spindle reorganization and restoration of the interphase nucleus. Alternatively spliced transcript variants encoding different isoforms have been described for this gene. [provided by RefSeq, Oct 2011]
Mouse(209091) cyclin B3
Rat(317389) cyclin B3
sheep(101102288) cyclin B3
Zebrafish(767751) cyclin B3
chicken(396167) cyclin B3
cow(100301478) cyclin B3
Horse(100063155) cyclin B3
dog(449494) cyclin B3
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_183015 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_183015 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_183015 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_033670 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_033670 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_033670 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU081081 MISSION® esiRNA esiRNA human CCNB3 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_033031 Rosetta Predictions human pricing
NM_033670 Rosetta Predictions human pricing
XM_001064448 Rosetta Predictions rat pricing
XM_228779 Rosetta Predictions rat pricing
NM_183015 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_033031 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00163445 predicted 3939
2 SASI_Hs01_00163446 predicted 3919
3 SASI_Hs02_00360722 predicted 4037
4 SASI_Hs01_00163447 predicted 3940
5 SASI_Hs01_00163448 predicted 4096
6 SASI_Hs01_00163450 predicted 3964
7 SASI_Hs01_00163451 predicted 3836
8 SASI_Hs01_00163452 predicted 3918
9 SASI_Hs01_00163453 predicted 4206
10 SASI_Hs01_00163454 predicted 4173
11 SASI_Hs01_00163449 predicted 4205
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_033670 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00074353 predicted 632
2 SASI_Hs01_00074354 predicted 602
3 SASI_Hs02_00361478 predicted 724
4 SASI_Hs01_00074355 predicted 626
5 SASI_Hs01_00074356 predicted 778
6 SASI_Hs01_00074358 predicted 658
7 SASI_Hs01_00074359 predicted 524
8 SASI_Hs01_00074360 predicted 601
9 SASI_Hs01_00074361 predicted 888
10 SASI_Hs01_00074362 predicted 853
11 SASI_Hs01_00074357 predicted 902
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001064448 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00310545 predicted 2995
2 SASI_Rn02_00310546 predicted 3705
3 SASI_Rn02_00310547 predicted 831
4 SASI_Rn02_00310548 predicted 2060
5 SASI_Rn02_00310549 predicted 3878
6 SASI_Rn02_00310550 predicted 2073
7 SASI_Rn02_00310551 predicted 3678
8 SASI_Rn02_00310552 predicted 3975
9 SASI_Rn02_00310553 predicted 1755
10 SASI_Rn02_00310554 predicted 1412
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_228779 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00385497 predicted 3000
2 SASI_Rn02_00385498 predicted 3705
3 SASI_Rn02_00385499 predicted 834
4 SASI_Rn02_00385500 predicted 2061
5 SASI_Rn02_00385501 predicted 3878
6 SASI_Rn02_00385502 predicted 2071
7 SASI_Rn02_00385503 predicted 3682
8 SASI_Rn02_00385504 predicted 3972
9 SASI_Rn02_00385505 predicted 1751
10 SASI_Rn02_00385506 predicted 1404
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_183015 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00044873 predicted 3106
2 SASI_Mm02_00350018 predicted 3699
3 SASI_Mm01_00044875 predicted 3365
4 SASI_Mm01_00044876 predicted 4241
5 SASI_Mm01_00044877 predicted 3722
6 SASI_Mm02_00350019 predicted 3293
7 SASI_Mm01_00044878 predicted 4079
8 SASI_Mm01_00044879 predicted 3744
9 SASI_Mm01_00044880 predicted 3513
10 SASI_Mm01_00044882 predicted 3155
11 SASI_Mm01_00044874 predicted 2891
12 SASI_Mm01_00044881 predicted 3790
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_183015
CCNB3 MISSION shRNA Bacterial Glycerol Stock
cyclin B3
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000087908    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_183015.1-4391s1c1
Sequence:CCGGGCATGAAGTTTCCCTATTGTTCTCGAGAACAATAGGGAAACTTCATGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000087909    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183015.1-442s1c1
Sequence:CCGGGCATGTTACTTCACTGTCAAACTCGAGTTTGACAGTGAAGTAACATGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000087910    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183015.1-4192s1c1
Sequence:CCGGCCGATCCCATAGTATCCTCAACTCGAGTTGAGGATACTATGGGATCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000087912    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183015.1-1037s1c1
Sequence:CCGGCCACAGGTGTTACAAGAGAATCTCGAGATTCTCTTGTAACACCTGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000087911    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183015.1-1182s1c1
Sequence:CCGGGCACTAATTTGAGGCCACTAACTCGAGTTAGTGGCCTCAAATTAGTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_183015
CCNB3 MISSION shRNA shRNA Plasmid DNA
cyclin B3
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000087908    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_183015.1-4391s1c1
Sequence:CCGGGCATGAAGTTTCCCTATTGTTCTCGAGAACAATAGGGAAACTTCATGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000087909    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183015.1-442s1c1
Sequence:CCGGGCATGTTACTTCACTGTCAAACTCGAGTTTGACAGTGAAGTAACATGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000087910    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183015.1-4192s1c1
Sequence:CCGGCCGATCCCATAGTATCCTCAACTCGAGTTGAGGATACTATGGGATCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000087912    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183015.1-1037s1c1
Sequence:CCGGCCACAGGTGTTACAAGAGAATCTCGAGATTCTCTTGTAACACCTGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000087911    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183015.1-1182s1c1
Sequence:CCGGGCACTAATTTGAGGCCACTAACTCGAGTTAGTGGCCTCAAATTAGTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_183015
CCNB3 MISSION shRNA Lentiviral Transduction Particles
cyclin B3
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000087908    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_183015.1-4391s1c1
Sequence:CCGGGCATGAAGTTTCCCTATTGTTCTCGAGAACAATAGGGAAACTTCATGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000087909    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183015.1-442s1c1
Sequence:CCGGGCATGTTACTTCACTGTCAAACTCGAGTTTGACAGTGAAGTAACATGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000087910    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183015.1-4192s1c1
Sequence:CCGGCCGATCCCATAGTATCCTCAACTCGAGTTGAGGATACTATGGGATCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000087912    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183015.1-1037s1c1
Sequence:CCGGCCACAGGTGTTACAAGAGAATCTCGAGATTCTCTTGTAACACCTGTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000087911    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183015.1-1182s1c1
Sequence:CCGGGCACTAATTTGAGGCCACTAACTCGAGTTAGTGGCCTCAAATTAGTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_033670
VALIDATED
CCNB3 MISSION shRNA Bacterial Glycerol Stock
cyclin B3
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000006458    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_033670.1-1017s1c1
Sequence:CCGGGCATGTTAACAGGGTATATTTCTCGAGAAATATACCCTGTTAACATGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000006460    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_033670.1-899s1c1
Sequence:CCGGGTCTTCTTTGAAGTCGCCAAACTCGAGTTTGGCGACTTCAAAGAAGACTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000006461    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033670.1-556s1c1
Sequence:CCGGCGTCCTCAAATGTGACATTAACTCGAGTTAATGTCACATTTGAGGACGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000006462    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033670.1-377s1c1
Sequence:CCGGCTCTACCTAATGAAGGCAGTACTCGAGTACTGCCTTCATTAGGTAGAGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000006459    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033670.1-601s1c1
Sequence:CCGGGCGCAGATATGCTAGGTGTATCTCGAGATACACCTAGCATATCTGCGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000314749    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033670.2-597s21c1
Sequence:CCGGGCGCAGATATGCTAGGTGTATCTCGAGATACACCTAGCATATCTGCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000314752    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_033670.2-1013s21c1
Sequence:CCGGGCATGTTAACAGGGTATATTTCTCGAGAAATATACCCTGTTAACATGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000314680    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033670.2-552s21c1
Sequence:CCGGCGTCCTCAAATGTGACATTAACTCGAGTTAATGTCACATTTGAGGACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000314753    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033670.2-218s21c1
Sequence:CCGGAGAATTGCCAAACGAAGATATCTCGAGATATCTTCGTTTGGCAATTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000314682    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033670.2-895s21c1
Sequence:CCGGGTCTTCTTTGAAGTCGCCAAACTCGAGTTTGGCGACTTCAAAGAAGACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_033670
VALIDATED
CCNB3 MISSION shRNA shRNA Plasmid DNA
cyclin B3
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000006458    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_033670.1-1017s1c1
Sequence:CCGGGCATGTTAACAGGGTATATTTCTCGAGAAATATACCCTGTTAACATGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000006460    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_033670.1-899s1c1
Sequence:CCGGGTCTTCTTTGAAGTCGCCAAACTCGAGTTTGGCGACTTCAAAGAAGACTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000006461    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033670.1-556s1c1
Sequence:CCGGCGTCCTCAAATGTGACATTAACTCGAGTTAATGTCACATTTGAGGACGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000006462    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033670.1-377s1c1
Sequence:CCGGCTCTACCTAATGAAGGCAGTACTCGAGTACTGCCTTCATTAGGTAGAGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000006459    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033670.1-601s1c1
Sequence:CCGGGCGCAGATATGCTAGGTGTATCTCGAGATACACCTAGCATATCTGCGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000314749    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033670.2-597s21c1
Sequence:CCGGGCGCAGATATGCTAGGTGTATCTCGAGATACACCTAGCATATCTGCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000314752    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_033670.2-1013s21c1
Sequence:CCGGGCATGTTAACAGGGTATATTTCTCGAGAAATATACCCTGTTAACATGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000314680    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033670.2-552s21c1
Sequence:CCGGCGTCCTCAAATGTGACATTAACTCGAGTTAATGTCACATTTGAGGACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000314753    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033670.2-218s21c1
Sequence:CCGGAGAATTGCCAAACGAAGATATCTCGAGATATCTTCGTTTGGCAATTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000314682    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033670.2-895s21c1
Sequence:CCGGGTCTTCTTTGAAGTCGCCAAACTCGAGTTTGGCGACTTCAAAGAAGACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_033670
VALIDATED
CCNB3 MISSION shRNA Lentiviral Transduction Particles
cyclin B3
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000006458    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_033670.1-1017s1c1
Sequence:CCGGGCATGTTAACAGGGTATATTTCTCGAGAAATATACCCTGTTAACATGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000006460    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_033670.1-899s1c1
Sequence:CCGGGTCTTCTTTGAAGTCGCCAAACTCGAGTTTGGCGACTTCAAAGAAGACTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000006461    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033670.1-556s1c1
Sequence:CCGGCGTCCTCAAATGTGACATTAACTCGAGTTAATGTCACATTTGAGGACGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000006462    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033670.1-377s1c1
Sequence:CCGGCTCTACCTAATGAAGGCAGTACTCGAGTACTGCCTTCATTAGGTAGAGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000006459    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033670.1-601s1c1
Sequence:CCGGGCGCAGATATGCTAGGTGTATCTCGAGATACACCTAGCATATCTGCGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000314749    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033670.2-597s21c1
Sequence:CCGGGCGCAGATATGCTAGGTGTATCTCGAGATACACCTAGCATATCTGCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000314752    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_033670.2-1013s21c1
Sequence:CCGGGCATGTTAACAGGGTATATTTCTCGAGAAATATACCCTGTTAACATGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000314680    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033670.2-552s21c1
Sequence:CCGGCGTCCTCAAATGTGACATTAACTCGAGTTAATGTCACATTTGAGGACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000314753    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033670.2-218s21c1
Sequence:CCGGAGAATTGCCAAACGAAGATATCTCGAGATATCTTCGTTTGGCAATTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000314682    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033670.2-895s21c1
Sequence:CCGGGTCTTCTTTGAAGTCGCCAAACTCGAGTTTGGCGACTTCAAAGAAGACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)