EMAIL THIS PAGE TO A FRIEND

CCNC

cyclin C

138 Gene Product Result for
Synonyms: CycC
UniProtKB ID: P24863, B4DPZ1, Q9H543
Gene ID:
Human(892) Summary: The protein encoded by this gene is a member of the cyclin family of proteins. The encoded protein interacts with cyclin-dependent kinase 8 and induces the phophorylation of the carboxy-terminal domain of the large subunit of RNA polymerase II. The level of mRNAs for this gene peaks in the G1 phase of the cell cycle. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
Mouse(51813) cyclin C
Rat(114839) cyclin C
cow(509717) cyclin C
dog(475007) cyclin C
chicken(421791) cyclin C
sheep(101102491) cyclin C
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_005190 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_005190 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_005190 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_016746 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_016746 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_016746 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001013399 siRNAs that have been validated in the lab human pricing
NM_005190 siRNAs that have been validated in the lab human pricing
NM_001100472 Rosetta Predictions rat pricing
NM_001122982 Rosetta Predictions mouse pricing
NM_016746 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001013399 siRNAs that have been validated in the lab Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00087590 validated 441
2 SASI_Hs01_00087589 predicted 746
3 SASI_Hs02_00306355 predicted 511
4 SASI_Hs01_00087592 predicted 507
5 SASI_Hs01_00087593 predicted 648
6 SASI_Hs01_00087594 predicted 965
7 SASI_Hs01_00087595 predicted 870
8 SASI_Hs01_00087596 predicted 471
9 SASI_Hs01_00087597 predicted 922
10 SASI_Hs01_00087598 predicted 637
11 SASI_Hs01_00087591 predicted 704
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_005190 siRNAs that have been validated in the lab Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00077509 validated 672
2 SASI_Hs02_00339138 predicted 736
3 SASI_Hs01_00077511 predicted 732
4 SASI_Hs01_00077512 predicted 870
5 SASI_Hs01_00077513 predicted 1181
6 SASI_Hs01_00077514 predicted 1094
7 SASI_Hs01_00077515 predicted 694
8 SASI_Hs01_00077516 predicted 1141
9 SASI_Hs01_00077517 predicted 536
10 SASI_Hs02_00339139 predicted 858
11 SASI_Hs01_00077508 predicted 969
12 SASI_Hs01_00077510 predicted 926
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001100472 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00209854 predicted 788
2 SASI_Rn02_00209855 predicted 316
3 SASI_Rn02_00209856 predicted 936
4 SASI_Rn02_00209857 predicted 680
5 SASI_Rn02_00209858 predicted 560
6 SASI_Rn02_00209859 predicted 855
7 SASI_Rn02_00209860 predicted 214
8 SASI_Rn02_00209861 predicted 359
9 SASI_Rn02_00209862 predicted 694
10 SASI_Rn02_00209863 predicted 551
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001122982 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00309719 predicted 258
2 SASI_Mm02_00309720 predicted 198
3 SASI_Mm02_00309721 predicted 636
4 SASI_Mm02_00309722 predicted 564
5 SASI_Mm02_00309723 predicted 469
6 SASI_Mm02_00309724 predicted 328
7 SASI_Mm02_00309725 predicted 429
8 SASI_Mm02_00309726 predicted 622
9 SASI_Mm02_00309727 predicted 284
10 SASI_Mm02_00309728 predicted 506
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_016746 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00031357 predicted 255
2 SASI_Mm02_00323472 predicted 205
3 SASI_Mm01_00031358 predicted 633
4 SASI_Mm02_00323473 predicted 564
5 SASI_Mm02_00323474 predicted 474
6 SASI_Mm01_00031359 predicted 328
7 SASI_Mm01_00031361 predicted 430
8 SASI_Mm01_00031362 predicted 621
9 SASI_Mm02_00323475 predicted 277
10 SASI_Mm02_00323476 predicted 506
11 SASI_Mm01_00031353 predicted 912
12 SASI_Mm01_00031354 predicted 844
13 SASI_Mm01_00031355 predicted 373
14 SASI_Mm01_00031356 predicted 995
15 SASI_Mm01_00031360 predicted 332
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_005190
VALIDATED
CCNC MISSION shRNA Bacterial Glycerol Stock
cyclin C
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000319188    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005190.3-481s21c1
Sequence:CCGGCTACGGTATATTTCAAGAGATCTCGAGATCTCTTGAAATATACCGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000319165    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005190.3-813s21c1
Sequence:CCGGGCATGGAGGATAGTGAATGATCTCGAGATCATTCACTATCCTCCATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000319166    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005190.3-1042s21c1
Sequence:CCGGCCATTCTTAGTAAGATGCCAACTCGAGTTGGCATCTTACTAAGAATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000319164    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005190.3-567s21c1
Sequence:CCGGGCATCCAAAGTAGAGGAATTTCTCGAGAAATTCCTCTACTTTGGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000020189    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005190.2-368s1c1
Sequence:CCGGGCATCCAAAGTAGAGGAATTTCTCGAGAAATTCCTCTACTTTGGATGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000020193    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_005190.2-114s1c1
Sequence:CCGGCCCACTATTTGCAATGGATTTCTCGAGAAATCCATTGCAAATAGTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000020192    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_005190.2-282s1c1
Sequence:CCGGCTACGGTATATTTCAAGAGATCTCGAGATCTCTTGAAATATACCGTAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000020190    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005190.2-843s1c1
Sequence:CCGGCCATTCTTAGTAAGATGCCAACTCGAGTTGGCATCTTACTAAGAATGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_005190
VALIDATED
CCNC MISSION shRNA shRNA Plasmid DNA
cyclin C
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000319188    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005190.3-481s21c1
Sequence:CCGGCTACGGTATATTTCAAGAGATCTCGAGATCTCTTGAAATATACCGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000319165    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005190.3-813s21c1
Sequence:CCGGGCATGGAGGATAGTGAATGATCTCGAGATCATTCACTATCCTCCATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000319166    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005190.3-1042s21c1
Sequence:CCGGCCATTCTTAGTAAGATGCCAACTCGAGTTGGCATCTTACTAAGAATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000319164    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005190.3-567s21c1
Sequence:CCGGGCATCCAAAGTAGAGGAATTTCTCGAGAAATTCCTCTACTTTGGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000020189    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005190.2-368s1c1
Sequence:CCGGGCATCCAAAGTAGAGGAATTTCTCGAGAAATTCCTCTACTTTGGATGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000020193    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_005190.2-114s1c1
Sequence:CCGGCCCACTATTTGCAATGGATTTCTCGAGAAATCCATTGCAAATAGTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000020192    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_005190.2-282s1c1
Sequence:CCGGCTACGGTATATTTCAAGAGATCTCGAGATCTCTTGAAATATACCGTAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000020190    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005190.2-843s1c1
Sequence:CCGGCCATTCTTAGTAAGATGCCAACTCGAGTTGGCATCTTACTAAGAATGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_005190
VALIDATED
CCNC MISSION shRNA Lentiviral Transduction Particles
cyclin C
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000319188    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005190.3-481s21c1
Sequence:CCGGCTACGGTATATTTCAAGAGATCTCGAGATCTCTTGAAATATACCGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000319165    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005190.3-813s21c1
Sequence:CCGGGCATGGAGGATAGTGAATGATCTCGAGATCATTCACTATCCTCCATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000319166    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005190.3-1042s21c1
Sequence:CCGGCCATTCTTAGTAAGATGCCAACTCGAGTTGGCATCTTACTAAGAATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000319164    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005190.3-567s21c1
Sequence:CCGGGCATCCAAAGTAGAGGAATTTCTCGAGAAATTCCTCTACTTTGGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000020189    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005190.2-368s1c1
Sequence:CCGGGCATCCAAAGTAGAGGAATTTCTCGAGAAATTCCTCTACTTTGGATGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000020193    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_005190.2-114s1c1
Sequence:CCGGCCCACTATTTGCAATGGATTTCTCGAGAAATCCATTGCAAATAGTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000020192    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_005190.2-282s1c1
Sequence:CCGGCTACGGTATATTTCAAGAGATCTCGAGATCTCTTGAAATATACCGTAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000020190    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005190.2-843s1c1
Sequence:CCGGCCATTCTTAGTAAGATGCCAACTCGAGTTGGCATCTTACTAAGAATGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_016746
VALIDATED
CCNC MISSION shRNA Bacterial Glycerol Stock
cyclin C
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000304593    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016746.3-565s21c1
Sequence:CCGGTCCTTACAGGATGAATCATATCTCGAGATATGATTCATCCTGTAAGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000302106    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016746.3-708s21c1
Sequence:CCGGCATGGAGGATAGTGAATGATACTCGAGTATCATTCACTATCCTCCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000304594    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016746.3-391s21c1
Sequence:CCGGGAGATTCTATGCTAGGTATTCCTCGAGGAATACCTAGCATAGAATCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000304592    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016746.3-1013s21c1
Sequence:CCGGTCTAGCTACAGCCAATCTTAACTCGAGTTAAGATTGGCTGTAGCTAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000304628    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016746.3-1141s21c1
Sequence:CCGGGCATATTGGGAATTGACTTAACTCGAGTTAAGTCAATTCCCAATATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000077828    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_016746.1-2208s1c1
Sequence:CCGGCGTGTTAAATTAGAGCCCTAACTCGAGTTAGGGCTCTAATTTAACACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000077829    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016746.1-735s1c1
Sequence:CCGGCCTCCGTTCATGATCGCTTTACTCGAGTAAAGCGATCATGAACGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000077831    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016746.1-306s1c1
Sequence:CCGGGCATTAGGTGAACATCTTAAACTCGAGTTTAAGATGTTCACCTAATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000077832    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016746.1-905s1c1
Sequence:CCGGGATGGCAACTATTCTTAGTAACTCGAGTTACTAAGAATAGTTGCCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000077830    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016746.1-685s1c1
Sequence:CCGGCATGGAGGATAGTGAATGATACTCGAGTATCATTCACTATCCTCCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_016746
VALIDATED
CCNC MISSION shRNA shRNA Plasmid DNA
cyclin C
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000304593    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016746.3-565s21c1
Sequence:CCGGTCCTTACAGGATGAATCATATCTCGAGATATGATTCATCCTGTAAGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000302106    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016746.3-708s21c1
Sequence:CCGGCATGGAGGATAGTGAATGATACTCGAGTATCATTCACTATCCTCCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000304594    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016746.3-391s21c1
Sequence:CCGGGAGATTCTATGCTAGGTATTCCTCGAGGAATACCTAGCATAGAATCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000304592    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016746.3-1013s21c1
Sequence:CCGGTCTAGCTACAGCCAATCTTAACTCGAGTTAAGATTGGCTGTAGCTAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000304628    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016746.3-1141s21c1
Sequence:CCGGGCATATTGGGAATTGACTTAACTCGAGTTAAGTCAATTCCCAATATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000077828    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_016746.1-2208s1c1
Sequence:CCGGCGTGTTAAATTAGAGCCCTAACTCGAGTTAGGGCTCTAATTTAACACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000077829    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016746.1-735s1c1
Sequence:CCGGCCTCCGTTCATGATCGCTTTACTCGAGTAAAGCGATCATGAACGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000077831    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016746.1-306s1c1
Sequence:CCGGGCATTAGGTGAACATCTTAAACTCGAGTTTAAGATGTTCACCTAATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000077832    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016746.1-905s1c1
Sequence:CCGGGATGGCAACTATTCTTAGTAACTCGAGTTACTAAGAATAGTTGCCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000077830    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016746.1-685s1c1
Sequence:CCGGCATGGAGGATAGTGAATGATACTCGAGTATCATTCACTATCCTCCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_016746
VALIDATED
CCNC MISSION shRNA Lentiviral Transduction Particles
cyclin C
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000304593    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016746.3-565s21c1
Sequence:CCGGTCCTTACAGGATGAATCATATCTCGAGATATGATTCATCCTGTAAGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000302106    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016746.3-708s21c1
Sequence:CCGGCATGGAGGATAGTGAATGATACTCGAGTATCATTCACTATCCTCCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000304594    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016746.3-391s21c1
Sequence:CCGGGAGATTCTATGCTAGGTATTCCTCGAGGAATACCTAGCATAGAATCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000304592    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016746.3-1013s21c1
Sequence:CCGGTCTAGCTACAGCCAATCTTAACTCGAGTTAAGATTGGCTGTAGCTAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000304628    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016746.3-1141s21c1
Sequence:CCGGGCATATTGGGAATTGACTTAACTCGAGTTAAGTCAATTCCCAATATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000077828    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_016746.1-2208s1c1
Sequence:CCGGCGTGTTAAATTAGAGCCCTAACTCGAGTTAGGGCTCTAATTTAACACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000077829    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016746.1-735s1c1
Sequence:CCGGCCTCCGTTCATGATCGCTTTACTCGAGTAAAGCGATCATGAACGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000077831    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016746.1-306s1c1
Sequence:CCGGGCATTAGGTGAACATCTTAAACTCGAGTTTAAGATGTTCACCTAATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000077832    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016746.1-905s1c1
Sequence:CCGGGATGGCAACTATTCTTAGTAACTCGAGTTACTAAGAATAGTTGCCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000077830    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016746.1-685s1c1
Sequence:CCGGCATGGAGGATAGTGAATGATACTCGAGTATCATTCACTATCCTCCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks