EMAIL THIS PAGE TO A FRIEND

CCND1

cyclin D1

142 Gene Product Result for
Synonyms: BCL1 D11S287E PRAD1 U21B31
UniProtKB ID: P24385, Q6LEF0
Gene ID:
Human(595) Summary: The protein encoded by this gene belongs to the highly conserved cyclin family, whose members are characterized by a dramatic periodicity in protein abundance throughout the cell cycle. Cyclins function as regulators of CDK kinases. Different cyclins exhibit distinct expression and degradation patterns which contribute to the temporal coordination of each mitotic event. This cyclin forms a complex with and functions as a regulatory subunit of CDK4 or CDK6, whose activity is required for cell cycle G1/S transition. This protein has been shown to interact with tumor suppressor protein Rb and the expression of this gene is regulated positively by Rb. Mutations, amplification and overexpression of this gene, which alters cell cycle progression, are observed frequently in a variety of tumors and may contribute to tumorigenesis. [provided by RefSeq, Jul 2008]
Mouse(12443) cyclin D1
Rat(58919) cyclin D1
sheep(100144763) cyclin D1
Zebrafish(30222) cyclin D1
dog(449028) cyclin D1
cow(524530) cyclin D1
chicken(396341) cyclin D1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB2100362 Anti-CCND1 (ab1) antibody produced in rabbit affinity isolated antibody canine, bovine, rat, guinea pig, zebrafish, human, horse, mouse
western blot pricing
SAB2100363 Anti-CCND1 (ab2) antibody produced in rabbit affinity isolated antibody , horse, rabbit, human, bovine, canine
western blot pricing
SAB2100364 Anti-CCND1 (ab3) antibody produced in rabbit affinity isolated antibody human, bovine, canine, rabbit, guinea pig, rat, rabbit, mouse
western blot pricing
SAB1405510 Anti-CCND1 antibody produced in mouse purified immunoglobulin, buffered aqueous solution human
western blot pricing
SAB2701688 Anti-ccnd1 antibody produced in rabbit affinity isolated antibody, buffered aqueous solution zebrafish
immunohistochemistry, western blot pricing
SAB2106484 Anti-CCND1 antibody produced in rabbit affinity isolated antibody horse, mouse, guinea pig, human
ELISA, western blot pricing
HPA027802 Anti-CCND1 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody New human
immunofluorescence pricing
SAB1306586 ANTI-CYCLIN D1 (S90) antibody produced in rabbit affinity isolated antibody, buffered aqueous solution human, mouse
immunofluorescence, immunohistochemistry, western blot pricing
C5588 Anti-Cyclin D1 antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human, rat
microarray, western blot pricing
SAB4502603 Anti-CYCLIN D1 antibody produced in rabbit affinity isolated antibody human, mouse, rat
ELISA, western blot pricing
SAB5500090 Anti-Cyclin D1 antibody, Rabbit monoclonal recombinant, expressed in proprietary host, clone SP4, tissue culture supernatant human (tested)
immunohistochemistry, western blot pricing
SAB4502602 Anti-CYCLIN D1, C-Terminal antibody produced in rabbit affinity isolated antibody mouse, rat, human
ELISA, immunohistochemistry, western blot pricing
SAB4504154 Anti-phospho-Cyclin D1 (pSer90) antibody produced in rabbit affinity isolated antibody rat, mouse, human
ELISA, immunohistochemistry pricing
SAB4301483 Anti-phospho-Cyclin D1 (pSer90) antibody produced in rabbit affinity isolated antibody human
western blot pricing
SAB4503862 Anti-phospho-Cyclin D1 (pThr286) antibody produced in rabbit affinity isolated antibody rat, human, mouse
ELISA, western blot pricing
SAB4301465 Anti-phospho-Cyclin D1 (pThr286) antibody produced in rabbit affinity isolated antibody human
western blot pricing
SAB4700017 Monoclonal Anti-CCND1 antibody produced in mouse clone CD1.1, purified immunoglobulin, buffered aqueous solution rat, human
flow cytometry pricing
SAB5300525 Monoclonal Anti-CCND1 antibody produced in mouse clone 3D8, ascites fluid human
ELISA, western blot pricing
C7464 Monoclonal Anti-Cyclin D1 antibody produced in mouse clone DCS-6, ascites fluid human, monkey, rat, mouse
immunocytochemistry, immunohistochemistry, immunoprecipitation, microarray, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_007631 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_007631 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_007631 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_053056 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_053056 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_053056 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_053056 siRNAs that have been validated in the lab human pricing
NM_171992 Rosetta Predictions rat pricing
NM_007631 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_053056 siRNAs that have been validated in the lab Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00213909 validated 769
2 SASI_Hs01_00213908 predicted 523
3 SASI_Hs01_00213910 predicted 1435
4 SASI_Hs01_00213911 predicted 889
5 SASI_Hs01_00213912 predicted 889
6 SASI_Hs01_00213913 predicted 1370
7 SASI_Hs01_00213914 predicted 840
8 SASI_Hs01_00213915 predicted 870
9 SASI_Hs01_00213916 predicted 1254
10 SASI_Hs01_00213917 predicted 770
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_171992 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00269089 predicted 483
2 SASI_Rn01_00036315 predicted 265
3 SASI_Rn01_00036317 predicted 813
4 SASI_Rn01_00036318 predicted 800
5 SASI_Rn02_00269090 predicted 601
6 SASI_Rn01_00036320 predicted 439
7 SASI_Rn02_00269091 predicted 492
8 SASI_Rn01_00036322 predicted 685
9 SASI_Rn02_00269092 predicted 862
10 SASI_Rn02_00269093 predicted 207
11 SASI_Rn01_00036316 predicted 535
12 SASI_Rn01_00036319 predicted 813
13 SASI_Rn01_00036321 predicted 665
14 SASI_Rn01_00036323 predicted 998
15 SASI_Rn01_00036324 predicted 638
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_007631 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00041294 predicted 759
2 SASI_Mm01_00041296 predicted 919
3 SASI_Mm01_00041297 predicted 909
4 SASI_Mm01_00041298 predicted 714
5 SASI_Mm01_00041299 predicted 547
6 SASI_Mm01_00041300 predicted 603
7 SASI_Mm01_00041301 predicted 570
8 SASI_Mm01_00041302 predicted 793
9 SASI_Mm01_00041303 predicted 975
10 SASI_Mm02_00312104 predicted 310
11 SASI_Mm01_00041295 predicted 494
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_007631
VALIDATED
CCND1 MISSION shRNA Bacterial Glycerol Stock
cyclin D1
Mouse
15 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000026948    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007631.1-706s1c1
Sequence:CCGGCCACAGATGTGAAGTTCATTTCTCGAGAAATGAACTTCACATCTGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000026910    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007631.1-879s1c1
Sequence:CCGGCAGGAACAGATTGAAGCCCTTCTCGAGAAGGGCTTCAATCTGTTCCTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000026951    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007631.1-254s1c1
Sequence:CCGGGCCCTCCGTATCTTACTTCAACTCGAGTTGAAGTAAGATACGGAGGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000026881    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_007631.1-511s1c1
Sequence:CCGGGCATCTACACTGACAACTCTACTCGAGTAGAGTTGTCAGTGTAGATGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000026883    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_007631.1-608s1c1
Sequence:CCGGCCACGATTTCATCGAACACTTCTCGAGAAGTGTTCGATGAAATCGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000055233    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007631.1-468s1c1
Sequence:CCGGTCTAAGATGAAGGAGACCATTCTCGAGAATGGTCTCCTTCATCTTAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000055234    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007631.1-260s1c1
Sequence:CCGGCGTATCTTACTTCAAGTGCGTCTCGAGACGCACTTGAAGTAAGATACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000055235    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_007631.1-830s1c1
Sequence:CCGGCTTTCTTTCCAGAGTCATCAACTCGAGTTGATGACTCTGGAAAGAAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000055236    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007631.1-188s1c1
Sequence:CCGGCCCTGACACCAATCTCCTCAACTCGAGTTGAGGAGATTGGTGTCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000055237    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007631.1-451s1c1
Sequence:CCGGCCTGCATGTTCGTGGCCTCTACTCGAGTAGAGGCCACGAACATGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000312946    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007631.2-801s21c1
Sequence:CCGGCCACAGATGTGAAGTTCATTTCTCGAGAAATGAACTTCACATCTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000312881    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.82 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_007631.2-1443s21c1
Sequence:CCGGCTGTTCTAAGAGTAGGATTAACTCGAGTTAATCCTACTCTTAGAACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000311853    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_007631.2-925s21c1
Sequence:CCGGCTTTCTTTCCAGAGTCATCAACTCGAGTTGATGACTCTGGAAAGAAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000312874    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007631.2-703s21c1
Sequence:CCGGCCACGATTTCATCGAACACTTCTCGAGAAGTGTTCGATGAAATCGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000312873    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_007631.2-606s21c1
Sequence:CCGGGCATCTACACTGACAACTCTACTCGAGTAGAGTTGTCAGTGTAGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_007631
VALIDATED
CCND1 MISSION shRNA shRNA Plasmid DNA
cyclin D1
Mouse
15 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000026948    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007631.1-706s1c1
Sequence:CCGGCCACAGATGTGAAGTTCATTTCTCGAGAAATGAACTTCACATCTGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000026910    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007631.1-879s1c1
Sequence:CCGGCAGGAACAGATTGAAGCCCTTCTCGAGAAGGGCTTCAATCTGTTCCTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000026951    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007631.1-254s1c1
Sequence:CCGGGCCCTCCGTATCTTACTTCAACTCGAGTTGAAGTAAGATACGGAGGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000026881    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_007631.1-511s1c1
Sequence:CCGGGCATCTACACTGACAACTCTACTCGAGTAGAGTTGTCAGTGTAGATGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000026883    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_007631.1-608s1c1
Sequence:CCGGCCACGATTTCATCGAACACTTCTCGAGAAGTGTTCGATGAAATCGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000055233    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007631.1-468s1c1
Sequence:CCGGTCTAAGATGAAGGAGACCATTCTCGAGAATGGTCTCCTTCATCTTAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000055234    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007631.1-260s1c1
Sequence:CCGGCGTATCTTACTTCAAGTGCGTCTCGAGACGCACTTGAAGTAAGATACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000055235    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_007631.1-830s1c1
Sequence:CCGGCTTTCTTTCCAGAGTCATCAACTCGAGTTGATGACTCTGGAAAGAAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000055236    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007631.1-188s1c1
Sequence:CCGGCCCTGACACCAATCTCCTCAACTCGAGTTGAGGAGATTGGTGTCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000055237    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007631.1-451s1c1
Sequence:CCGGCCTGCATGTTCGTGGCCTCTACTCGAGTAGAGGCCACGAACATGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000312946    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007631.2-801s21c1
Sequence:CCGGCCACAGATGTGAAGTTCATTTCTCGAGAAATGAACTTCACATCTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000312881    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.82 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_007631.2-1443s21c1
Sequence:CCGGCTGTTCTAAGAGTAGGATTAACTCGAGTTAATCCTACTCTTAGAACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000311853    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_007631.2-925s21c1
Sequence:CCGGCTTTCTTTCCAGAGTCATCAACTCGAGTTGATGACTCTGGAAAGAAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000312874    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007631.2-703s21c1
Sequence:CCGGCCACGATTTCATCGAACACTTCTCGAGAAGTGTTCGATGAAATCGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000312873    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_007631.2-606s21c1
Sequence:CCGGGCATCTACACTGACAACTCTACTCGAGTAGAGTTGTCAGTGTAGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_007631
VALIDATED
CCND1 MISSION shRNA Lentiviral Transduction Particles
cyclin D1
Mouse
15 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000026948    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007631.1-706s1c1
Sequence:CCGGCCACAGATGTGAAGTTCATTTCTCGAGAAATGAACTTCACATCTGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000026910    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007631.1-879s1c1
Sequence:CCGGCAGGAACAGATTGAAGCCCTTCTCGAGAAGGGCTTCAATCTGTTCCTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000026951    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007631.1-254s1c1
Sequence:CCGGGCCCTCCGTATCTTACTTCAACTCGAGTTGAAGTAAGATACGGAGGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000026881    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_007631.1-511s1c1
Sequence:CCGGGCATCTACACTGACAACTCTACTCGAGTAGAGTTGTCAGTGTAGATGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000026883    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_007631.1-608s1c1
Sequence:CCGGCCACGATTTCATCGAACACTTCTCGAGAAGTGTTCGATGAAATCGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000055233    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007631.1-468s1c1
Sequence:CCGGTCTAAGATGAAGGAGACCATTCTCGAGAATGGTCTCCTTCATCTTAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000055234    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007631.1-260s1c1
Sequence:CCGGCGTATCTTACTTCAAGTGCGTCTCGAGACGCACTTGAAGTAAGATACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000055235    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_007631.1-830s1c1
Sequence:CCGGCTTTCTTTCCAGAGTCATCAACTCGAGTTGATGACTCTGGAAAGAAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000055236    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007631.1-188s1c1
Sequence:CCGGCCCTGACACCAATCTCCTCAACTCGAGTTGAGGAGATTGGTGTCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000055237    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007631.1-451s1c1
Sequence:CCGGCCTGCATGTTCGTGGCCTCTACTCGAGTAGAGGCCACGAACATGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000312946    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007631.2-801s21c1
Sequence:CCGGCCACAGATGTGAAGTTCATTTCTCGAGAAATGAACTTCACATCTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000312881    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.82 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_007631.2-1443s21c1
Sequence:CCGGCTGTTCTAAGAGTAGGATTAACTCGAGTTAATCCTACTCTTAGAACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000311853    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_007631.2-925s21c1
Sequence:CCGGCTTTCTTTCCAGAGTCATCAACTCGAGTTGATGACTCTGGAAAGAAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000312874    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007631.2-703s21c1
Sequence:CCGGCCACGATTTCATCGAACACTTCTCGAGAAGTGTTCGATGAAATCGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000312873    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_007631.2-606s21c1
Sequence:CCGGGCATCTACACTGACAACTCTACTCGAGTAGAGTTGTCAGTGTAGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_053056
VALIDATED
CCND1 MISSION shRNA Bacterial Glycerol Stock
cyclin D1
Human
13 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000010317    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.56 Cell Line: A549
TRC Version: 1 Clone ID:NM_053056.x-3664s1c1
Sequence:CCGGATTGGAATAGCTTCTGGAATCTCGAGATTCCAGAAGCTATTCCAATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000010315    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053056.x-689s1c1
Sequence:CCGGCATTGAACACTTCCTCTCCAACTCGAGTTGGAGAGGAAGTGTTCAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000010316    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_053056.x-1702s1c1
Sequence:CCGGTATTATATTCCGTAGGTAGATCTCGAGATCTACCTACGGAATATAATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000040042    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053056.1-728s1c1
Sequence:CCGGGAACAAACAGATCATCCGCAACTCGAGTTGCGGATGATCTGTTTGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000040041    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053056.1-326s1c1
Sequence:CCGGGCCCTCGGTGTCCTACTTCAACTCGAGTTGAAGTAGGACACCGAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000040040    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053056.1-539s1c1
Sequence:CCGGCTCTAAGATGAAGGAGACCATCTCGAGATGGTCTCCTTCATCTTAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000040039    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053056.1-680s1c1
Sequence:CCGGGCACGATTTCATTGAACACTTCTCGAGAAGTGTTCAATGAAATCGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000040038    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_053056.1-2322s1c1
Sequence:CCGGGCCAGGATGATAAGTTCCTTTCTCGAGAAAGGAACTTATCATCCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000288598    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 2 Clone ID:NM_053056.2-728s21c1
Sequence:CCGGGAACAAACAGATCATCCGCAACTCGAGTTGCGGATGATCTGTTTGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000295876    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 2 Clone ID:NM_053056.2-1440s21c1
Sequence:CCGGTGTTGTAAGAATAGGCATTAACTCGAGTTAATGCCTATTCTTACAACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000295875    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 2 Clone ID:NM_053056.2-904s21c1
Sequence:CCGGTCCTCTCCAGAGTGATCAAGTCTCGAGACTTGATCACTCTGGAGAGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000295874    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_053056.2-871s21c1
Sequence:CCGGACAACTTCCTGTCCTACTACCCTCGAGGGTAGTAGGACAGGAAGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000295873    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 2 Clone ID:NM_053056.2-778s21c1
Sequence:CCGGCCACAGATGTGAAGTTCATTTCTCGAGAAATGAACTTCACATCTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_053056
VALIDATED
CCND1 MISSION shRNA shRNA Plasmid DNA
cyclin D1
Human
13 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000010317    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.56 Cell Line: A549
TRC Version: 1 Clone ID:NM_053056.x-3664s1c1
Sequence:CCGGATTGGAATAGCTTCTGGAATCTCGAGATTCCAGAAGCTATTCCAATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000010315    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053056.x-689s1c1
Sequence:CCGGCATTGAACACTTCCTCTCCAACTCGAGTTGGAGAGGAAGTGTTCAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000010316    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_053056.x-1702s1c1
Sequence:CCGGTATTATATTCCGTAGGTAGATCTCGAGATCTACCTACGGAATATAATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000040042    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053056.1-728s1c1
Sequence:CCGGGAACAAACAGATCATCCGCAACTCGAGTTGCGGATGATCTGTTTGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000040041    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053056.1-326s1c1
Sequence:CCGGGCCCTCGGTGTCCTACTTCAACTCGAGTTGAAGTAGGACACCGAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000040040    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053056.1-539s1c1
Sequence:CCGGCTCTAAGATGAAGGAGACCATCTCGAGATGGTCTCCTTCATCTTAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000040039    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053056.1-680s1c1
Sequence:CCGGGCACGATTTCATTGAACACTTCTCGAGAAGTGTTCAATGAAATCGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000040038    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_053056.1-2322s1c1
Sequence:CCGGGCCAGGATGATAAGTTCCTTTCTCGAGAAAGGAACTTATCATCCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000288598    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 2 Clone ID:NM_053056.2-728s21c1
Sequence:CCGGGAACAAACAGATCATCCGCAACTCGAGTTGCGGATGATCTGTTTGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000295876    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 2 Clone ID:NM_053056.2-1440s21c1
Sequence:CCGGTGTTGTAAGAATAGGCATTAACTCGAGTTAATGCCTATTCTTACAACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000295875    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 2 Clone ID:NM_053056.2-904s21c1
Sequence:CCGGTCCTCTCCAGAGTGATCAAGTCTCGAGACTTGATCACTCTGGAGAGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000295874    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_053056.2-871s21c1
Sequence:CCGGACAACTTCCTGTCCTACTACCCTCGAGGGTAGTAGGACAGGAAGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000295873    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 2 Clone ID:NM_053056.2-778s21c1
Sequence:CCGGCCACAGATGTGAAGTTCATTTCTCGAGAAATGAACTTCACATCTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_053056
VALIDATED
CCND1 MISSION shRNA Lentiviral Transduction Particles
cyclin D1
Human
13 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000010317    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.56 Cell Line: A549
TRC Version: 1 Clone ID:NM_053056.x-3664s1c1
Sequence:CCGGATTGGAATAGCTTCTGGAATCTCGAGATTCCAGAAGCTATTCCAATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000010315    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053056.x-689s1c1
Sequence:CCGGCATTGAACACTTCCTCTCCAACTCGAGTTGGAGAGGAAGTGTTCAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000010316    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_053056.x-1702s1c1
Sequence:CCGGTATTATATTCCGTAGGTAGATCTCGAGATCTACCTACGGAATATAATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000040042    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053056.1-728s1c1
Sequence:CCGGGAACAAACAGATCATCCGCAACTCGAGTTGCGGATGATCTGTTTGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000040041    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053056.1-326s1c1
Sequence:CCGGGCCCTCGGTGTCCTACTTCAACTCGAGTTGAAGTAGGACACCGAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000040040    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053056.1-539s1c1
Sequence:CCGGCTCTAAGATGAAGGAGACCATCTCGAGATGGTCTCCTTCATCTTAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000040039    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053056.1-680s1c1
Sequence:CCGGGCACGATTTCATTGAACACTTCTCGAGAAGTGTTCAATGAAATCGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000040038    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_053056.1-2322s1c1
Sequence:CCGGGCCAGGATGATAAGTTCCTTTCTCGAGAAAGGAACTTATCATCCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000288598    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 2 Clone ID:NM_053056.2-728s21c1
Sequence:CCGGGAACAAACAGATCATCCGCAACTCGAGTTGCGGATGATCTGTTTGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000295876    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 2 Clone ID:NM_053056.2-1440s21c1
Sequence:CCGGTGTTGTAAGAATAGGCATTAACTCGAGTTAATGCCTATTCTTACAACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000295875    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 2 Clone ID:NM_053056.2-904s21c1
Sequence:CCGGTCCTCTCCAGAGTGATCAAGTCTCGAGACTTGATCACTCTGGAGAGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000295874    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_053056.2-871s21c1
Sequence:CCGGACAACTTCCTGTCCTACTACCCTCGAGGGTAGTAGGACAGGAAGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000295873    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 2 Clone ID:NM_053056.2-778s21c1
Sequence:CCGGCCACAGATGTGAAGTTCATTTCTCGAGAAATGAACTTCACATCTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks