EMAIL THIS PAGE TO A FRIEND

CCND2

cyclin D2

Synonyms: KIAK0002
UniProtKB ID: P30279, A8K531, Q13955, Q5U035
Gene ID:
Human(894) Summary: The protein encoded by this gene belongs to the highly conserved cyclin family, whose members are characterized by a dramatic periodicity in protein abundance through the cell cycle. Cyclins function as regulators of CDK kinases. Different cyclins exhibit distinct expression and degradation patterns which contribute to the temporal coordination of each mitotic event. This cyclin forms a complex with and functions as a regulatory subunit of CDK4 or CDK6, whose activity is required for cell cycle G1/S transition. This protein has been shown to interact with and be involved in the phosphorylation of tumor suppressor protein Rb. Knockout studies of the homologous gene in mouse suggest the essential roles of this gene in ovarian granulosa and germ cell proliferation. High level expression of this gene was observed in ovarian and testicular tumors. [provided by RefSeq, Oct 2008]
Mouse(12444) cyclin D2
Rat(64033) cyclin D2
chicken(374047) cyclin D2
cow(615414) cyclin D2
dog(611782) cyclin D2
sheep(100147799) cyclin D2
219 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_009829 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_009829 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_009829 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_001759 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001759 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001759 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001759 Rosetta Predictions human pricing
NM_022267 Rosetta Predictions rat pricing
NM_009829 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001759 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00043350 predicted 732
2 SASI_Hs01_00043351 predicted 819
3 SASI_Hs01_00043352 predicted 911
4 SASI_Hs01_00043354 predicted 720
5 SASI_Hs01_00043355 predicted 727
6 SASI_Hs01_00043356 predicted 939
7 SASI_Hs01_00043357 predicted 539
8 SASI_Hs01_00043358 predicted 832
9 SASI_Hs01_00043359 predicted 947
10 SASI_Hs02_00332485 predicted 725
11 SASI_Hs01_00043353 predicted 734
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_022267 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00121816 predicted 575
2 SASI_Rn01_00121818 predicted 546
3 SASI_Rn01_00121819 predicted 529
4 SASI_Rn01_00121820 predicted 362
5 SASI_Rn01_00121821 predicted 406
6 SASI_Rn01_00121822 predicted 458
7 SASI_Rn01_00121823 predicted 559
8 SASI_Rn01_00121824 predicted 631
9 SASI_Rn01_00121825 predicted 564
10 SASI_Rn02_00263072 predicted 536
11 SASI_Rn01_00121817 predicted 276
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_009829 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00124359 predicted 847
2 SASI_Mm01_00124360 predicted 941
3 SASI_Mm01_00124362 predicted 636
4 SASI_Mm01_00124363 predicted 692
5 SASI_Mm01_00124364 predicted 1516
6 SASI_Mm01_00124365 predicted 1598
7 SASI_Mm01_00124366 predicted 940
8 SASI_Mm01_00124368 predicted 893
9 SASI_Mm02_00317175 predicted 828
10 SASI_Mm02_00317176 predicted 837
11 SASI_Mm01_00124361 predicted 456
12 SASI_Mm01_00124367 predicted 685
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_009829
VALIDATED
CCND2 MISSION shRNA Bacterial Glycerol Stock
cyclin D2
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000362652    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009829.3-1053s21c1
Sequence:CCGGTTCCGTCAAGAGCAGCATAACCTCGAGGTTATGCTGCTCTTGACGGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000362653    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009829.3-1391s21c1
Sequence:CCGGTGTACACTCGAACCGTTATTACTCGAGTAATAACGGTTCGAGTGTACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000362585    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009829.3-1482s21c1
Sequence:CCGGCTGCAACATGGGAACGAATTACTCGAGTAATTCGTTCCCATGTTGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000054763    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_009829.2-365s1c1
Sequence:CCGGCCCGCAGTGTTCCTATTTCAACTCGAGTTGAAATAGGAACACTGCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000054766    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_009829.2-728s1c1
Sequence:CCGGCATTGAGCACATCCTTCGCAACTCGAGTTGCGAAGGATGTGCTCAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000054767    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009829.2-395s1c1
Sequence:CCGGGAAGGACATCCAACCGTACATCTCGAGATGTACGGTTGGATGTCCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000054765    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009829.2-525s1c1
Sequence:CCGGCCGACTCCTAAGACCCATCTTCTCGAGAAGATGGGTCTTAGGAGTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000054764    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_009829.2-821s1c1
Sequence:CCGGCGACTTCAAGTTTGCCATGTACTCGAGTACATGGCAAACTTGAAGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_009829
VALIDATED
CCND2 MISSION shRNA shRNA Plasmid DNA
cyclin D2
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000362652    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009829.3-1053s21c1
Sequence:CCGGTTCCGTCAAGAGCAGCATAACCTCGAGGTTATGCTGCTCTTGACGGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000362653    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009829.3-1391s21c1
Sequence:CCGGTGTACACTCGAACCGTTATTACTCGAGTAATAACGGTTCGAGTGTACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000362585    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009829.3-1482s21c1
Sequence:CCGGCTGCAACATGGGAACGAATTACTCGAGTAATTCGTTCCCATGTTGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000054763    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_009829.2-365s1c1
Sequence:CCGGCCCGCAGTGTTCCTATTTCAACTCGAGTTGAAATAGGAACACTGCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000054766    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_009829.2-728s1c1
Sequence:CCGGCATTGAGCACATCCTTCGCAACTCGAGTTGCGAAGGATGTGCTCAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000054767    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009829.2-395s1c1
Sequence:CCGGGAAGGACATCCAACCGTACATCTCGAGATGTACGGTTGGATGTCCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000054765    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009829.2-525s1c1
Sequence:CCGGCCGACTCCTAAGACCCATCTTCTCGAGAAGATGGGTCTTAGGAGTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000054764    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_009829.2-821s1c1
Sequence:CCGGCGACTTCAAGTTTGCCATGTACTCGAGTACATGGCAAACTTGAAGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_009829
VALIDATED
CCND2 MISSION shRNA Lentiviral Transduction Particles
cyclin D2
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000362652    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009829.3-1053s21c1
Sequence:CCGGTTCCGTCAAGAGCAGCATAACCTCGAGGTTATGCTGCTCTTGACGGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000362653    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009829.3-1391s21c1
Sequence:CCGGTGTACACTCGAACCGTTATTACTCGAGTAATAACGGTTCGAGTGTACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000362585    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009829.3-1482s21c1
Sequence:CCGGCTGCAACATGGGAACGAATTACTCGAGTAATTCGTTCCCATGTTGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000054763    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_009829.2-365s1c1
Sequence:CCGGCCCGCAGTGTTCCTATTTCAACTCGAGTTGAAATAGGAACACTGCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000054766    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_009829.2-728s1c1
Sequence:CCGGCATTGAGCACATCCTTCGCAACTCGAGTTGCGAAGGATGTGCTCAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000054767    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009829.2-395s1c1
Sequence:CCGGGAAGGACATCCAACCGTACATCTCGAGATGTACGGTTGGATGTCCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000054765    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009829.2-525s1c1
Sequence:CCGGCCGACTCCTAAGACCCATCTTCTCGAGAAGATGGGTCTTAGGAGTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000054764    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_009829.2-821s1c1
Sequence:CCGGCGACTTCAAGTTTGCCATGTACTCGAGTACATGGCAAACTTGAAGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001759
VALIDATED
CCND2 MISSION shRNA Bacterial Glycerol Stock
cyclin D2
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000286546    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001759.3-875s21c1
Sequence:CCGGCGACTTTAAGTTTGCCATGTACTCGAGTACATGGCAAACTTAAAGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000286478    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001759.3-1009s21c1
Sequence:CCGGTCACCAACACAGACGTGGATTCTCGAGAATCCACGTCTGTGTTGGTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000286477    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001759.3-901s21c1
Sequence:CCGGCGTCGATGATCGCAACTGGAACTCGAGTTCCAGTTGCGATCATCGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000286545    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001759.3-449s21c1
Sequence:CCGGGAAGGACATCCAACCCTACATCTCGAGATGTAGGGTTGGATGTCCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000298622    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.66 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001759.3-1575s21c1
Sequence:CCGGAGGAACTGTGTACGCCATTTACTCGAGTAAATGGCGTACACAGTTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000045294    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_001759.2-973s1c1
Sequence:CCGGTCACCAACACAGACGTGGATTCTCGAGAATCCACGTCTGTGTTGGTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000045296    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_001759.2-380s1c1
Sequence:CCGGCCTTCCGCAGTGCTCCTACTTCTCGAGAAGTAGGAGCACTGCGGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000045297    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_001759.2-865s1c1
Sequence:CCGGCGTCGATGATCGCAACTGGAACTCGAGTTCCAGTTGCGATCATCGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000045295    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_001759.2-413s1c1
Sequence:CCGGGAAGGACATCCAACCCTACATCTCGAGATGTAGGGTTGGATGTCCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000045293    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_001759.2-839s1c1
Sequence:CCGGCGACTTTAAGTTTGCCATGTACTCGAGTACATGGCAAACTTAAAGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001759
VALIDATED
CCND2 MISSION shRNA shRNA Plasmid DNA
cyclin D2
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000286546    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001759.3-875s21c1
Sequence:CCGGCGACTTTAAGTTTGCCATGTACTCGAGTACATGGCAAACTTAAAGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000286478    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001759.3-1009s21c1
Sequence:CCGGTCACCAACACAGACGTGGATTCTCGAGAATCCACGTCTGTGTTGGTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000286477    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001759.3-901s21c1
Sequence:CCGGCGTCGATGATCGCAACTGGAACTCGAGTTCCAGTTGCGATCATCGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000286545    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001759.3-449s21c1
Sequence:CCGGGAAGGACATCCAACCCTACATCTCGAGATGTAGGGTTGGATGTCCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000298622    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.66 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001759.3-1575s21c1
Sequence:CCGGAGGAACTGTGTACGCCATTTACTCGAGTAAATGGCGTACACAGTTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000045294    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_001759.2-973s1c1
Sequence:CCGGTCACCAACACAGACGTGGATTCTCGAGAATCCACGTCTGTGTTGGTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000045296    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_001759.2-380s1c1
Sequence:CCGGCCTTCCGCAGTGCTCCTACTTCTCGAGAAGTAGGAGCACTGCGGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000045297    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_001759.2-865s1c1
Sequence:CCGGCGTCGATGATCGCAACTGGAACTCGAGTTCCAGTTGCGATCATCGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000045295    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_001759.2-413s1c1
Sequence:CCGGGAAGGACATCCAACCCTACATCTCGAGATGTAGGGTTGGATGTCCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000045293    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_001759.2-839s1c1
Sequence:CCGGCGACTTTAAGTTTGCCATGTACTCGAGTACATGGCAAACTTAAAGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001759
VALIDATED
CCND2 MISSION shRNA Lentiviral Transduction Particles
cyclin D2
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000286546    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001759.3-875s21c1
Sequence:CCGGCGACTTTAAGTTTGCCATGTACTCGAGTACATGGCAAACTTAAAGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000286478    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001759.3-1009s21c1
Sequence:CCGGTCACCAACACAGACGTGGATTCTCGAGAATCCACGTCTGTGTTGGTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000286477    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001759.3-901s21c1
Sequence:CCGGCGTCGATGATCGCAACTGGAACTCGAGTTCCAGTTGCGATCATCGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000286545    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001759.3-449s21c1
Sequence:CCGGGAAGGACATCCAACCCTACATCTCGAGATGTAGGGTTGGATGTCCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000298622    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.66 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001759.3-1575s21c1
Sequence:CCGGAGGAACTGTGTACGCCATTTACTCGAGTAAATGGCGTACACAGTTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000045294    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_001759.2-973s1c1
Sequence:CCGGTCACCAACACAGACGTGGATTCTCGAGAATCCACGTCTGTGTTGGTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000045296    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_001759.2-380s1c1
Sequence:CCGGCCTTCCGCAGTGCTCCTACTTCTCGAGAAGTAGGAGCACTGCGGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000045297    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_001759.2-865s1c1
Sequence:CCGGCGTCGATGATCGCAACTGGAACTCGAGTTCCAGTTGCGATCATCGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000045295    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_001759.2-413s1c1
Sequence:CCGGGAAGGACATCCAACCCTACATCTCGAGATGTAGGGTTGGATGTCCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000045293    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_001759.2-839s1c1
Sequence:CCGGCGACTTTAAGTTTGCCATGTACTCGAGTACATGGCAAACTTAAAGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks