EMAIL THIS PAGE TO A FRIEND

CCND3

cyclin D3

113 Gene Product Result for
Gene ID:
Human(896) Summary: The protein encoded by this gene belongs to the highly conserved cyclin family, whose members are characterized by a dramatic periodicity in protein abundance through the cell cycle. Cyclins function as regulators of CDK kinases. Different cyclins exhibit distinct expression and degradation patterns which contribute to the temporal coordination of each mitotic event. This cyclin forms a complex with and functions as a regulatory subunit of CDK4 or CDK6, whose activtiy is required for cell cycle G1/S transition. This protein has been shown to interact with and be involved in the phosphorylation of tumor suppressor protein Rb. The CDK4 activity associated with this cyclin was reported to be necessary for cell cycle progression through G2 phase into mitosis after UV radiation. Several transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Oct 2008]
Mouse(12445) cyclin D3
Rat(25193) cyclin D3
Zebrafish(449996) cyclin D3
cow(540547) cyclin D3
dog(608847) cyclin D3
chicken(419928) cyclin D3
sheep(100147798) cyclin D3
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
C5372 Anti-CCND3 (273-285) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
western blot pricing
SAB1400042 Anti-CCND3 antibody produced in mouse IgG fraction of antiserum, buffered aqueous solution human
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
AV03038 Anti-CCND3 antibody produced in rabbit affinity isolated antibody mouse, pig, rat, bovine, sheep, canine, human, guinea pig
immunohistochemistry, western blot pricing
SAB1411589 Anti-CCND3 antibody produced in rabbit purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing
HPA055107 Anti-CCND3 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody New human
immunofluorescence pricing
SAB5500091 Anti-Cyclin D3 antibody, Rabbit monoclonal recombinant, expressed in proprietary host, clone SP207, affinity isolated antibody human (tested)
flow cytometry, immunohistochemistry, western blot pricing
SAB4503512 Anti-Cyclin D3, C-Terminal antibody produced in rabbit affinity isolated antibody mouse, rat, human
ELISA, immunohistochemistry, western blot pricing
SAB4503863 Anti-phospho-Cyclin D3 (pThr283) antibody produced in rabbit affinity isolated antibody rat, mouse, human
ELISA, immunohistochemistry, western blot pricing
SAB4301500 Anti-phospho-Cyclin D3 (pThr283) antibody produced in rabbit affinity isolated antibody human, mouse, rat
western blot pricing
SAB5300352 Monoclonal Anti-CCND3 antibody produced in mouse clone 6H4, ascites fluid human, mouse
ELISA, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_007632 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_007632 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_007632 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_001760 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001760 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001760 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU129741 MISSION® esiRNA esiRNA human CCND3 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001760 Rosetta Predictions human pricing
NM_012766 Rosetta Predictions rat pricing
NM_001081635 Rosetta Predictions mouse pricing
NM_001081636 Rosetta Predictions mouse pricing
NM_007632 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001760 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00050184 predicted 729
2 SASI_Hs01_00050185 predicted 619
3 SASI_Hs01_00050186 predicted 631
4 SASI_Hs01_00050188 predicted 832
5 SASI_Hs01_00050189 predicted 746
6 SASI_Hs01_00050190 predicted 1007
7 SASI_Hs01_00050191 predicted 539
8 SASI_Hs01_00050192 predicted 849
9 SASI_Hs01_00050193 predicted 443
10 SASI_Hs02_00332486 predicted 1116
11 SASI_Hs01_00050187 predicted 1110
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_012766 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00069472 predicted 641
2 SASI_Rn01_00069473 predicted 1398
3 SASI_Rn01_00069474 predicted 545
4 SASI_Rn01_00069475 predicted 1147
5 SASI_Rn01_00069476 predicted 436
6 SASI_Rn01_00069477 predicted 1304
7 SASI_Rn01_00069478 predicted 938
8 SASI_Rn02_00260142 predicted 1403
9 SASI_Rn01_00069479 predicted 763
10 SASI_Rn02_00260143 predicted 352
11 SASI_Rn01_00069480 predicted 755
12 SASI_Rn01_00069481 predicted 450
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001081635 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00298730 predicted 1217
2 SASI_Mm02_00298731 predicted 1226
3 SASI_Mm02_00298732 predicted 845
4 SASI_Mm02_00298733 predicted 1484
5 SASI_Mm02_00298734 predicted 1542
6 SASI_Mm02_00298735 predicted 560
7 SASI_Mm02_00298736 predicted 1140
8 SASI_Mm02_00298737 predicted 958
9 SASI_Mm02_00298738 predicted 762
10 SASI_Mm02_00298739 predicted 954
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001081636 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00298740 predicted 1262
2 SASI_Mm02_00298741 predicted 1271
3 SASI_Mm02_00298742 predicted 895
4 SASI_Mm02_00298743 predicted 1529
5 SASI_Mm02_00298744 predicted 1585
6 SASI_Mm02_00298745 predicted 602
7 SASI_Mm02_00298746 predicted 1186
8 SASI_Mm02_00298747 predicted 998
9 SASI_Mm02_00298748 predicted 808
10 SASI_Mm02_00298749 predicted 1004
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_007632 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00084556 predicted 1126
2 SASI_Mm01_00084557 predicted 1128
3 SASI_Mm01_00084558 predicted 753
4 SASI_Mm01_00084559 predicted 1387
5 SASI_Mm01_00084560 predicted 1445
6 SASI_Mm01_00084561 predicted 464
7 SASI_Mm01_00084562 predicted 1046
8 SASI_Mm01_00084563 predicted 856
9 SASI_Mm01_00084564 predicted 670
10 SASI_Mm02_00312105 predicted 862
11 SASI_Mm01_00084555 predicted 583
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_007632
VALIDATED
CCND3 MISSION shRNA Bacterial Glycerol Stock
cyclin D3
Mouse
13 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000054893    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007632.1-1310s1c1
Sequence:CCGGCCAACCTTCTCAGTTGCCAAACTCGAGTTTGGCAACTGAGAAGGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000054895    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007632.1-810s1c1
Sequence:CCGGACTGAAGTGGACTGCCTGCGACTCGAGTCGCAGGCAGTCCACTTCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000054896    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007632.1-957s1c1
Sequence:CCGGCCCACAGATGTCACAGCCATTCTCGAGAATGGCTGTGACATCTGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000011978    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007632.1-1231s1c1
Sequence:CCGGGCCATGATGGTCAGAGAAATACTCGAGTATTTCTCTGACCATCATGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000011981    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007632.1-795s1c1
Sequence:CCGGGCCGGGATCACAGGCACTGAACTCGAGTTCAGTGCCTGTGATCCCGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000011982    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007632.1-263s1c1
Sequence:CCGGCAAGCCGCACATGCGGAAGATCTCGAGATCTTCCGCATGTGCGGCTTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000011980    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007632.1-578s1c1
Sequence:CCGGGCACGACTTCCTGGCCTTGATCTCGAGATCAAGGCCAGGAAGTCGTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000011979    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007632.1-688s1c1
Sequence:CCGGCCTTTGCGATGTATCCTCCATCTCGAGATGGAGGATACATCGCAAAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000287251    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007632.2-891s21c1
Sequence:CCGGACTGAAGTGGACTGCCTGCGACTCGAGTCGCAGGCAGTCCACTTCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000287250    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007632.2-1391s21c1
Sequence:CCGGCCAACCTTCTCAGTTGCCAAACTCGAGTTTGGCAACTGAGAAGGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000294761    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007632.2-659s21c1
Sequence:CCGGGCACGACTTCCTGGCCTTGATCTCGAGATCAAGGCCAGGAAGTCGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000294760    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007632.2-769s21c1
Sequence:CCGGCCTTTGCGATGTATCCTCCATCTCGAGATGGAGGATACATCGCAAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000294817    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007632.2-1312s21c1
Sequence:CCGGGCCATGATGGTCAGAGAAATACTCGAGTATTTCTCTGACCATCATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_007632
VALIDATED
CCND3 MISSION shRNA shRNA Plasmid DNA
cyclin D3
Mouse
13 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000054893    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007632.1-1310s1c1
Sequence:CCGGCCAACCTTCTCAGTTGCCAAACTCGAGTTTGGCAACTGAGAAGGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000054895    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007632.1-810s1c1
Sequence:CCGGACTGAAGTGGACTGCCTGCGACTCGAGTCGCAGGCAGTCCACTTCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000054896    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007632.1-957s1c1
Sequence:CCGGCCCACAGATGTCACAGCCATTCTCGAGAATGGCTGTGACATCTGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000011978    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007632.1-1231s1c1
Sequence:CCGGGCCATGATGGTCAGAGAAATACTCGAGTATTTCTCTGACCATCATGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000011981    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007632.1-795s1c1
Sequence:CCGGGCCGGGATCACAGGCACTGAACTCGAGTTCAGTGCCTGTGATCCCGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000011982    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007632.1-263s1c1
Sequence:CCGGCAAGCCGCACATGCGGAAGATCTCGAGATCTTCCGCATGTGCGGCTTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000011980    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007632.1-578s1c1
Sequence:CCGGGCACGACTTCCTGGCCTTGATCTCGAGATCAAGGCCAGGAAGTCGTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000011979    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007632.1-688s1c1
Sequence:CCGGCCTTTGCGATGTATCCTCCATCTCGAGATGGAGGATACATCGCAAAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000287251    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007632.2-891s21c1
Sequence:CCGGACTGAAGTGGACTGCCTGCGACTCGAGTCGCAGGCAGTCCACTTCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000287250    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007632.2-1391s21c1
Sequence:CCGGCCAACCTTCTCAGTTGCCAAACTCGAGTTTGGCAACTGAGAAGGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000294761    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007632.2-659s21c1
Sequence:CCGGGCACGACTTCCTGGCCTTGATCTCGAGATCAAGGCCAGGAAGTCGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000294760    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007632.2-769s21c1
Sequence:CCGGCCTTTGCGATGTATCCTCCATCTCGAGATGGAGGATACATCGCAAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000294817    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007632.2-1312s21c1
Sequence:CCGGGCCATGATGGTCAGAGAAATACTCGAGTATTTCTCTGACCATCATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_007632
VALIDATED
CCND3 MISSION shRNA Lentiviral Transduction Particles
cyclin D3
Mouse
13 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000054893    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007632.1-1310s1c1
Sequence:CCGGCCAACCTTCTCAGTTGCCAAACTCGAGTTTGGCAACTGAGAAGGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000054895    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007632.1-810s1c1
Sequence:CCGGACTGAAGTGGACTGCCTGCGACTCGAGTCGCAGGCAGTCCACTTCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000054896    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007632.1-957s1c1
Sequence:CCGGCCCACAGATGTCACAGCCATTCTCGAGAATGGCTGTGACATCTGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000011978    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007632.1-1231s1c1
Sequence:CCGGGCCATGATGGTCAGAGAAATACTCGAGTATTTCTCTGACCATCATGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000011981    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007632.1-795s1c1
Sequence:CCGGGCCGGGATCACAGGCACTGAACTCGAGTTCAGTGCCTGTGATCCCGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000011982    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007632.1-263s1c1
Sequence:CCGGCAAGCCGCACATGCGGAAGATCTCGAGATCTTCCGCATGTGCGGCTTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000011980    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007632.1-578s1c1
Sequence:CCGGGCACGACTTCCTGGCCTTGATCTCGAGATCAAGGCCAGGAAGTCGTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000011979    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007632.1-688s1c1
Sequence:CCGGCCTTTGCGATGTATCCTCCATCTCGAGATGGAGGATACATCGCAAAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000287251    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007632.2-891s21c1
Sequence:CCGGACTGAAGTGGACTGCCTGCGACTCGAGTCGCAGGCAGTCCACTTCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000287250    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007632.2-1391s21c1
Sequence:CCGGCCAACCTTCTCAGTTGCCAAACTCGAGTTTGGCAACTGAGAAGGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000294761    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007632.2-659s21c1
Sequence:CCGGGCACGACTTCCTGGCCTTGATCTCGAGATCAAGGCCAGGAAGTCGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000294760    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007632.2-769s21c1
Sequence:CCGGCCTTTGCGATGTATCCTCCATCTCGAGATGGAGGATACATCGCAAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000294817    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007632.2-1312s21c1
Sequence:CCGGGCCATGATGGTCAGAGAAATACTCGAGTATTTCTCTGACCATCATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001760
VALIDATED
CCND3 MISSION shRNA Bacterial Glycerol Stock
cyclin D3
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000003826    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_001760.x-1003s1c1
Sequence:CCGGCAGACCAGCACTCCTACAGATCTCGAGATCTGTAGGAGTGCTGGTCTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000003828    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_001760.x-634s1c1
Sequence:CCGGGCACATGATTTCCTGGCCTTCCTCGAGGAAGGCCAGGAAATCATGTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000003830    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_001760.x-1434s1c1
Sequence:CCGGCTAGGGTTATTGCATTTGGATCTCGAGATCCAAATGCAATAACCCTAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000003829    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_001760.x-1007s1c1
Sequence:CCGGCCAGCACTCCTACAGATGTCACTCGAGTGACATCTGTAGGAGTGCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000003827    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1 Clone ID:NM_001760.x-379s1c1
Sequence:CCGGCGCTGTGAGGAGGAAGTCTTCCTCGAGGAAGACTTCCTCCTCACAGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000338377    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001760.3-379s21c1
Sequence:CCGGCGCTGTGAGGAGGAAGTCTTCCTCGAGGAAGACTTCCTCCTCACAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000338380    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001760.3-1434s21c1
Sequence:CCGGCTAGGGTTATTGCATTTGGATCTCGAGATCCAAATGCAATAACCCTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000338378    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001760.3-634s21c1
Sequence:CCGGGCACATGATTTCCTGGCCTTCCTCGAGGAAGGCCAGGAAATCATGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000338379    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001760.3-1007s21c1
Sequence:CCGGCCAGCACTCCTACAGATGTCACTCGAGTGACATCTGTAGGAGTGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001760
VALIDATED
CCND3 MISSION shRNA shRNA Plasmid DNA
cyclin D3
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000003826    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_001760.x-1003s1c1
Sequence:CCGGCAGACCAGCACTCCTACAGATCTCGAGATCTGTAGGAGTGCTGGTCTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000003828    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_001760.x-634s1c1
Sequence:CCGGGCACATGATTTCCTGGCCTTCCTCGAGGAAGGCCAGGAAATCATGTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000003830    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_001760.x-1434s1c1
Sequence:CCGGCTAGGGTTATTGCATTTGGATCTCGAGATCCAAATGCAATAACCCTAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000003829    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_001760.x-1007s1c1
Sequence:CCGGCCAGCACTCCTACAGATGTCACTCGAGTGACATCTGTAGGAGTGCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000003827    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1 Clone ID:NM_001760.x-379s1c1
Sequence:CCGGCGCTGTGAGGAGGAAGTCTTCCTCGAGGAAGACTTCCTCCTCACAGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000338377    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001760.3-379s21c1
Sequence:CCGGCGCTGTGAGGAGGAAGTCTTCCTCGAGGAAGACTTCCTCCTCACAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000338380    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001760.3-1434s21c1
Sequence:CCGGCTAGGGTTATTGCATTTGGATCTCGAGATCCAAATGCAATAACCCTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000338378    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001760.3-634s21c1
Sequence:CCGGGCACATGATTTCCTGGCCTTCCTCGAGGAAGGCCAGGAAATCATGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000338379    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001760.3-1007s21c1
Sequence:CCGGCCAGCACTCCTACAGATGTCACTCGAGTGACATCTGTAGGAGTGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001760
VALIDATED
CCND3 MISSION shRNA Lentiviral Transduction Particles
cyclin D3
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000003826    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_001760.x-1003s1c1
Sequence:CCGGCAGACCAGCACTCCTACAGATCTCGAGATCTGTAGGAGTGCTGGTCTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000003828    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_001760.x-634s1c1
Sequence:CCGGGCACATGATTTCCTGGCCTTCCTCGAGGAAGGCCAGGAAATCATGTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000003830    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_001760.x-1434s1c1
Sequence:CCGGCTAGGGTTATTGCATTTGGATCTCGAGATCCAAATGCAATAACCCTAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000003829    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_001760.x-1007s1c1
Sequence:CCGGCCAGCACTCCTACAGATGTCACTCGAGTGACATCTGTAGGAGTGCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000003827    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1 Clone ID:NM_001760.x-379s1c1
Sequence:CCGGCGCTGTGAGGAGGAAGTCTTCCTCGAGGAAGACTTCCTCCTCACAGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000338377    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001760.3-379s21c1
Sequence:CCGGCGCTGTGAGGAGGAAGTCTTCCTCGAGGAAGACTTCCTCCTCACAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000338380    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001760.3-1434s21c1
Sequence:CCGGCTAGGGTTATTGCATTTGGATCTCGAGATCCAAATGCAATAACCCTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000338378    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001760.3-634s21c1
Sequence:CCGGGCACATGATTTCCTGGCCTTCCTCGAGGAAGGCCAGGAAATCATGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000338379    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001760.3-1007s21c1
Sequence:CCGGCCAGCACTCCTACAGATGTCACTCGAGTGACATCTGTAGGAGTGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks