EMAIL THIS PAGE TO A FRIEND

CCNDBP1

cyclin D-type binding-protein 1

Synonyms: DIP1 GCIP HHM
Gene ID:
Human(23582) Summary: This gene was identified by the interaction of its gene product with Grap2, a leukocyte-specific adaptor protein important for immune cell signaling. The protein encoded by this gene was shown to interact with cyclin D. Transfection of this gene in cells was reported to reduce the phosphorylation of Rb gene product by cyclin D-dependent protein kinase, and inhibit E2F1-mediated transcription activity. This protein was also found to interact with helix-loop-helix protein E12 and is thought to be a negative regulator of liver-specific gene expression. Several alternatively spliced variants have been found for this gene. [provided by RefSeq, Apr 2009]
Mouse(17151) cyclin D-type binding-protein 1
Rat(362201) cyclin D-type binding-protein 1
chicken(419217) cyclin D-type binding-protein 1
dog(607896) cyclin D-type binding-protein 1
cow(617512) cyclin D-type binding-protein 1
domestic cat(101100394) cyclin D-type binding-protein 1
naked mole-rat(101715315) cyclin D-type binding-protein 1
domestic guinea pig(100723755) cyclin D-type binding-protein 1
sheep(101120086) cyclin D-type binding-protein 1
151 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_012142 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_012142 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_012142 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_010761 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_010761 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_010761 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU068421 MISSION® esiRNA esiRNA human CCNDBP1 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_012142 Rosetta Predictions human pricing
NM_037370 Rosetta Predictions human pricing
NM_001013204 Rosetta Predictions rat pricing
NM_010761 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_012142 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00247026 predicted 645
2 SASI_Hs01_00247027 predicted 1307
3 SASI_Hs01_00247028 predicted 1223
4 SASI_Hs01_00247029 predicted 540
5 SASI_Hs01_00247030 predicted 1213
6 SASI_Hs01_00247031 predicted 1245
7 SASI_Hs01_00247033 predicted 530
8 SASI_Hs01_00247034 predicted 631
9 SASI_Hs01_00247035 predicted 527
10 SASI_Hs02_00343705 predicted 579
11 SASI_Hs01_00247032 predicted 1359
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_037370 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00042312 predicted 1189
2 SASI_Hs01_00042313 predicted 528
3 SASI_Hs01_00042314 predicted 1101
4 SASI_Hs01_00042315 predicted 1226
5 SASI_Hs01_00042316 predicted 421
6 SASI_Hs02_00361479 predicted 1091
7 SASI_Hs01_00042318 predicted 1126
8 SASI_Hs02_00361480 predicted 1243
9 SASI_Hs01_00042320 predicted 514
10 SASI_Hs01_00042321 predicted 466
11 SASI_Hs01_00042317 predicted 1064
12 SASI_Hs01_00042319 predicted 1241
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001013204 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00119935 predicted 199
2 SASI_Rn01_00119936 predicted 593
3 SASI_Rn02_00200984 predicted 866
4 SASI_Rn01_00119937 predicted 286
5 SASI_Rn01_00119938 predicted 300
6 SASI_Rn01_00119939 predicted 525
7 SASI_Rn01_00119940 predicted 691
8 SASI_Rn01_00119941 predicted 285
9 SASI_Rn01_00119943 predicted 293
10 SASI_Rn01_00119944 predicted 1036
11 SASI_Rn01_00119942 predicted 1023
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_010761 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00319287 predicted 258
2 SASI_Mm02_00319288 predicted 425
3 SASI_Mm01_00111168 predicted 296
4 SASI_Mm02_00319289 predicted 1013
5 SASI_Mm01_00111171 predicted 388
6 SASI_Mm02_00319290 predicted 379
7 SASI_Mm02_00319291 predicted 351
8 SASI_Mm02_00319292 predicted 733
9 SASI_Mm02_00319293 predicted 415
10 SASI_Mm02_00319294 predicted 528
11 SASI_Mm01_00111163 predicted 608
12 SASI_Mm01_00111164 predicted 443
13 SASI_Mm01_00111165 predicted 837
14 SASI_Mm01_00111166 predicted 434
15 SASI_Mm01_00111167 predicted 209
16 SASI_Mm01_00111169 predicted 919
17 SASI_Mm01_00111170 predicted 909
18 SASI_Mm01_00111172 predicted 936
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_012142
VALIDATED
CCNDBP1 MISSION shRNA Bacterial Glycerol Stock
cyclin D-type binding-protein 1
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000432498    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012142.3-937s21c1
Sequence:CCGGGACGATCAAGAGCTCATAATCCTCGAGGATTATGAGCTCTTGATCGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000415591    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012142.3-1099s21c1
Sequence:CCGGGATTTGGCTCTGAGCATATATCTCGAGATATATGCTCAGAGCCAAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000421822    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_012142.3-1628s21c1
Sequence:CCGGGATGTTGATGGTCTCAATAAACTCGAGTTTATTGAGACCATCAACATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000045208    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_012142.2-587s1c1
Sequence:CCGGCCTGAGAACAATGACCTTATTCTCGAGAATAAGGTCATTGTTCTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000045210    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 1 Clone ID:NM_012142.2-289s1c1
Sequence:CCGGCGAGGAGTTTAATCGAGAGATCTCGAGATCTCTCGATTAAACTCCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000045212    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012142.2-833s1c1
Sequence:CCGGCCCAGCAATCAGGACTTGTATCTCGAGATACAAGTCCTGATTGCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000045211    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: A549
TRC Version: 1 Clone ID:NM_012142.2-932s1c1
Sequence:CCGGCGGATGTTAGTGGCAGAGAATCTCGAGATTCTCTGCCACTAACATCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000045209    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012142.2-1066s1c1
Sequence:CCGGCGTGCGAATCAATTCTGCGAACTCGAGTTCGCAGAATTGATTCGCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_012142
VALIDATED
CCNDBP1 MISSION shRNA shRNA Plasmid DNA
cyclin D-type binding-protein 1
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000432498    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012142.3-937s21c1
Sequence:CCGGGACGATCAAGAGCTCATAATCCTCGAGGATTATGAGCTCTTGATCGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000415591    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012142.3-1099s21c1
Sequence:CCGGGATTTGGCTCTGAGCATATATCTCGAGATATATGCTCAGAGCCAAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000421822    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_012142.3-1628s21c1
Sequence:CCGGGATGTTGATGGTCTCAATAAACTCGAGTTTATTGAGACCATCAACATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000045208    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_012142.2-587s1c1
Sequence:CCGGCCTGAGAACAATGACCTTATTCTCGAGAATAAGGTCATTGTTCTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000045210    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 1 Clone ID:NM_012142.2-289s1c1
Sequence:CCGGCGAGGAGTTTAATCGAGAGATCTCGAGATCTCTCGATTAAACTCCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000045212    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012142.2-833s1c1
Sequence:CCGGCCCAGCAATCAGGACTTGTATCTCGAGATACAAGTCCTGATTGCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000045211    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: A549
TRC Version: 1 Clone ID:NM_012142.2-932s1c1
Sequence:CCGGCGGATGTTAGTGGCAGAGAATCTCGAGATTCTCTGCCACTAACATCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000045209    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012142.2-1066s1c1
Sequence:CCGGCGTGCGAATCAATTCTGCGAACTCGAGTTCGCAGAATTGATTCGCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_012142
VALIDATED
CCNDBP1 MISSION shRNA Lentiviral Transduction Particles
cyclin D-type binding-protein 1
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000432498    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012142.3-937s21c1
Sequence:CCGGGACGATCAAGAGCTCATAATCCTCGAGGATTATGAGCTCTTGATCGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000415591    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012142.3-1099s21c1
Sequence:CCGGGATTTGGCTCTGAGCATATATCTCGAGATATATGCTCAGAGCCAAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000421822    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_012142.3-1628s21c1
Sequence:CCGGGATGTTGATGGTCTCAATAAACTCGAGTTTATTGAGACCATCAACATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000045208    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_012142.2-587s1c1
Sequence:CCGGCCTGAGAACAATGACCTTATTCTCGAGAATAAGGTCATTGTTCTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000045210    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 1 Clone ID:NM_012142.2-289s1c1
Sequence:CCGGCGAGGAGTTTAATCGAGAGATCTCGAGATCTCTCGATTAAACTCCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000045212    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012142.2-833s1c1
Sequence:CCGGCCCAGCAATCAGGACTTGTATCTCGAGATACAAGTCCTGATTGCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000045211    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: A549
TRC Version: 1 Clone ID:NM_012142.2-932s1c1
Sequence:CCGGCGGATGTTAGTGGCAGAGAATCTCGAGATTCTCTGCCACTAACATCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000045209    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012142.2-1066s1c1
Sequence:CCGGCGTGCGAATCAATTCTGCGAACTCGAGTTCGCAGAATTGATTCGCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_010761
VALIDATED
CCNDBP1 MISSION shRNA Bacterial Glycerol Stock
cyclin D-type binding-protein 1
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000334284    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010761.2-308s21c1
Sequence:CCGGCGCACTTCTCTAAACTTCCATCTCGAGATGGAAGTTTAGAGAAGTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000334287    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010761.2-1355s21c1
Sequence:CCGGGCTAGGAGAGATTGCAGTTATCTCGAGATAACTGCAATCTCTCCTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000334218    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010761.2-522s21c1
Sequence:CCGGCACTGAGAATGGTGACCTGATCTCGAGATCAGGTCACCATTCTCAGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000334285    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010761.2-1002s21c1
Sequence:CCGGGCGGATCAGTTCTGCGAAATTCTCGAGAATTTCGCAGAACTGATCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000077819    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_010761.1-923s1c1
Sequence:CCGGGCGGATCAGTTCTGCGAAATTCTCGAGAATTTCGCAGAACTGATCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000077820    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_010761.1-226s1c1
Sequence:CCGGCGCACTTCTCTAAACTTCCATCTCGAGATGGAAGTTTAGAGAAGTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000077818    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.96 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_010761.1-1276s1c1
Sequence:CCGGGCTAGGAGAGATTGCAGTTATCTCGAGATAACTGCAATCTCTCCTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000077821    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_010761.1-451s1c1
Sequence:CCGGGTGACCTGATTTCCTGCAATACTCGAGTATTGCAGGAAATCAGGTCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000077822    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_010761.1-440s1c1
Sequence:CCGGCACTGAGAATGGTGACCTGATCTCGAGATCAGGTCACCATTCTCAGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_010761
VALIDATED
CCNDBP1 MISSION shRNA shRNA Plasmid DNA
cyclin D-type binding-protein 1
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000334284    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010761.2-308s21c1
Sequence:CCGGCGCACTTCTCTAAACTTCCATCTCGAGATGGAAGTTTAGAGAAGTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000334287    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010761.2-1355s21c1
Sequence:CCGGGCTAGGAGAGATTGCAGTTATCTCGAGATAACTGCAATCTCTCCTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000334218    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010761.2-522s21c1
Sequence:CCGGCACTGAGAATGGTGACCTGATCTCGAGATCAGGTCACCATTCTCAGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000334285    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010761.2-1002s21c1
Sequence:CCGGGCGGATCAGTTCTGCGAAATTCTCGAGAATTTCGCAGAACTGATCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000077819    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_010761.1-923s1c1
Sequence:CCGGGCGGATCAGTTCTGCGAAATTCTCGAGAATTTCGCAGAACTGATCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000077820    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_010761.1-226s1c1
Sequence:CCGGCGCACTTCTCTAAACTTCCATCTCGAGATGGAAGTTTAGAGAAGTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000077818    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.96 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_010761.1-1276s1c1
Sequence:CCGGGCTAGGAGAGATTGCAGTTATCTCGAGATAACTGCAATCTCTCCTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000077821    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_010761.1-451s1c1
Sequence:CCGGGTGACCTGATTTCCTGCAATACTCGAGTATTGCAGGAAATCAGGTCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000077822    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_010761.1-440s1c1
Sequence:CCGGCACTGAGAATGGTGACCTGATCTCGAGATCAGGTCACCATTCTCAGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_010761
VALIDATED
CCNDBP1 MISSION shRNA Lentiviral Transduction Particles
cyclin D-type binding-protein 1
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000334284    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010761.2-308s21c1
Sequence:CCGGCGCACTTCTCTAAACTTCCATCTCGAGATGGAAGTTTAGAGAAGTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000334287    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010761.2-1355s21c1
Sequence:CCGGGCTAGGAGAGATTGCAGTTATCTCGAGATAACTGCAATCTCTCCTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000334218    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010761.2-522s21c1
Sequence:CCGGCACTGAGAATGGTGACCTGATCTCGAGATCAGGTCACCATTCTCAGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000334285    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010761.2-1002s21c1
Sequence:CCGGGCGGATCAGTTCTGCGAAATTCTCGAGAATTTCGCAGAACTGATCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000077819    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_010761.1-923s1c1
Sequence:CCGGGCGGATCAGTTCTGCGAAATTCTCGAGAATTTCGCAGAACTGATCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000077820    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_010761.1-226s1c1
Sequence:CCGGCGCACTTCTCTAAACTTCCATCTCGAGATGGAAGTTTAGAGAAGTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000077818    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.96 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_010761.1-1276s1c1
Sequence:CCGGGCTAGGAGAGATTGCAGTTATCTCGAGATAACTGCAATCTCTCCTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000077821    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_010761.1-451s1c1
Sequence:CCGGGTGACCTGATTTCCTGCAATACTCGAGTATTGCAGGAAATCAGGTCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000077822    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_010761.1-440s1c1
Sequence:CCGGCACTGAGAATGGTGACCTGATCTCGAGATCAGGTCACCATTCTCAGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks