EMAIL THIS PAGE TO A FRIEND

CCNE1

cyclin E1

134 Gene Product Result for
Synonyms: CCNE
UniProtKB ID: P24864, A8K684, Q14091, Q8NFG1, Q92501, Q9UD21
Gene ID:
Human(898) Summary: The protein encoded by this gene belongs to the highly conserved cyclin family, whose members are characterized by a dramatic periodicity in protein abundance through the cell cycle. Cyclins function as regulators of CDK kinases. Different cyclins exhibit distinct expression and degradation patterns which contribute to the temporal coordination of each mitotic event. This cyclin forms a complex with and functions as a regulatory subunit of CDK2, whose activity is required for cell cycle G1/S transition. This protein accumulates at the G1-S phase boundary and is degraded as cells progress through S phase. Overexpression of this gene has been observed in many tumors, which results in chromosome instability, and thus may contribute to tumorigenesis. This protein was found to associate with, and be involved in, the phosphorylation of NPAT protein (nuclear protein mapped to the ATM locus), which participates in cell-cycle regulated histone gene expression and plays a critical role in promoting cell-cycle progression in the absence of pRB. Two alternatively spliced transcript variants of this gene, which encode distinct isoforms, have been described. Two additional splice variants were reported but detailed nucleotide sequence information is not yet available. [provided by RefSeq, Jul 2008]
Mouse(12447) cyclin E1
Rat(25729) cyclin E1
sheep(101107124) cyclin E1
Zebrafish(30188) cyclin E1
cow(533526) cyclin E1
Horse(100053882) cyclin E1
chicken(426117) cyclin E1
dog(484610) cyclin E1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
C4997 Anti-CCNE1 (346-360) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
western blot pricing
C4872 Anti-CCNE1 (6-20) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
western blot pricing
SAB1400043 Anti-CCNE1 antibody produced in mouse IgG fraction of antiserum, buffered aqueous solution human
ELISA, immunofluorescence, western blot pricing
HPA018169 Anti-CCNE1 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunofluorescence, immunohistochemistry pricing
SAB1400044 Anti-CCNE1 antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
ELISA, proximity ligation assay, western blot pricing
SAB4503515 Anti-Cyclin E1 antibody produced in rabbit affinity isolated antibody human
ELISA, immunofluorescence, immunohistochemistry pricing
SAB4503516 Anti-Cyclin E1 antibody produced in rabbit affinity isolated antibody human, rat, mouse
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
SAB5500092 Anti-Cyclin E1 antibody, Rabbit monoclonal clone SP146, recombinant, expressed in proprietary host, affinity isolated antibody human (tested)
immunohistochemistry pricing
SAB4503514 Anti-Cyclin E1, C-Terminal antibody produced in rabbit affinity isolated antibody human
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
SAB1105209 Anti-phospho-CCNE1 (pThr395) antibody produced in rabbit IgG fraction of antiserum human
western blot pricing
SAB4300684 Anti-phospho-Cyclin E1 (pThr395) antibody produced in rabbit affinity isolated antibody human
western blot pricing
SAB4503816 Anti-phospho-Cyclin E1 (pThr395) antibody produced in rabbit affinity isolated antibody rat, human, mouse
ELISA, immunohistochemistry, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_007633 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_007633 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_007633 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_001238 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001238 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001238 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001238 Rosetta Predictions human pricing
NM_057182 Rosetta Predictions human pricing
NM_001100821 Rosetta Predictions rat pricing
NM_007633 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001238 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00130048 predicted 948
2 SASI_Hs01_00130049 predicted 706
3 SASI_Hs01_00130050 predicted 1140
4 SASI_Hs01_00130051 predicted 745
5 SASI_Hs01_00130052 predicted 852
6 SASI_Hs01_00130053 predicted 1053
7 SASI_Hs01_00130054 predicted 1238
8 SASI_Hs01_00130055 predicted 555
9 SASI_Hs01_00130056 predicted 1130
10 SASI_Hs01_00130057 predicted 682
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_057182 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00058249 predicted 773
2 SASI_Hs01_00058250 predicted 527
3 SASI_Hs01_00058251 predicted 973
4 SASI_Hs01_00058252 predicted 567
5 SASI_Hs01_00058253 predicted 678
6 SASI_Hs01_00058254 predicted 882
7 SASI_Hs01_00058255 predicted 1068
8 SASI_Hs01_00058256 predicted 388
9 SASI_Hs01_00058257 predicted 957
10 SASI_Hs01_00058258 predicted 514
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001100821 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00210652 predicted 791
2 SASI_Rn02_00210653 predicted 438
3 SASI_Rn02_00210654 predicted 897
4 SASI_Rn02_00210655 predicted 1119
5 SASI_Rn02_00210656 predicted 1039
6 SASI_Rn02_00210657 predicted 300
7 SASI_Rn02_00210658 predicted 1190
8 SASI_Rn02_00210659 predicted 752
9 SASI_Rn02_00210660 predicted 913
10 SASI_Rn02_00210661 predicted 1029
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_007633 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00113065 predicted 805
2 SASI_Mm01_00113073 predicted 622
3 SASI_Mm01_00113068 predicted 528
4 SASI_Mm02_00312106 predicted 1061
5 SASI_Mm01_00113069 predicted 868
6 SASI_Mm02_00312107 predicted 322
7 SASI_Mm01_00113071 predicted 759
8 SASI_Mm01_00113072 predicted 770
9 SASI_Mm01_00113074 predicted 905
10 SASI_Mm02_00312108 predicted 1193
11 SASI_Mm01_00113066 predicted 287
12 SASI_Mm01_00113067 predicted 390
13 SASI_Mm01_00113070 predicted 1166
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_007633
VALIDATED
CCNE1 MISSION shRNA Bacterial Glycerol Stock
cyclin E1
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000077774    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007633.1-261s1c1
Sequence:CCGGCCTAACAAAGAAGAGGACAATCTCGAGATTGTCCTCTTCTTTGTTAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000077776    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007633.1-1165s1c1
Sequence:CCGGCCATATTGTCAGAACAGAATACTCGAGTATTCTGTTCTGACAATATGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000077777    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007633.1-211s1c1
Sequence:CCGGCCTGGGATGATAATTCAGCATCTCGAGATGCTGAATTATCATCCCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000077775    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007633.1-564s1c1
Sequence:CCGGGCATCACAACAGAATATCATACTCGAGTATGATATTCTGTTGTGATGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000222722    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007633.1-1607s1c2
Sequence:CCGGCGGGTGTTGTAGGTTGCTGTTCTCGAGAACAGCAACCTACAACACCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000313875    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007633.2-718s21c1
Sequence:CCGGTACATGGCATCACAACATAATCTCGAGATTATGTTGTGATGCCATGTATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000313874    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007633.2-1186s21c1
Sequence:CCGGGTTCCGTTCGCCATGGTTATCCTCGAGGATAACCATGGCGAACGGAACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000317392    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007633.2-371s21c1
Sequence:CCGGCCTGGGATGATAATTCAGCATCTCGAGATGCTGAATTATCATCCCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000317460    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007633.2-1325s21c1
Sequence:CCGGCCATATTGTCAGAACAGAATACTCGAGTATTCTGTTCTGACAATATGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000317461    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007633.2-1766s21c1
Sequence:CCGGCGGGTGTTGTAGGTTGCTGTTCTCGAGAACAGCAACCTACAACACCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_007633
VALIDATED
CCNE1 MISSION shRNA shRNA Plasmid DNA
cyclin E1
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000077774    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007633.1-261s1c1
Sequence:CCGGCCTAACAAAGAAGAGGACAATCTCGAGATTGTCCTCTTCTTTGTTAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000077776    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007633.1-1165s1c1
Sequence:CCGGCCATATTGTCAGAACAGAATACTCGAGTATTCTGTTCTGACAATATGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000077777    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007633.1-211s1c1
Sequence:CCGGCCTGGGATGATAATTCAGCATCTCGAGATGCTGAATTATCATCCCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000077775    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007633.1-564s1c1
Sequence:CCGGGCATCACAACAGAATATCATACTCGAGTATGATATTCTGTTGTGATGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000222722    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007633.1-1607s1c2
Sequence:CCGGCGGGTGTTGTAGGTTGCTGTTCTCGAGAACAGCAACCTACAACACCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000313875    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007633.2-718s21c1
Sequence:CCGGTACATGGCATCACAACATAATCTCGAGATTATGTTGTGATGCCATGTATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000313874    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007633.2-1186s21c1
Sequence:CCGGGTTCCGTTCGCCATGGTTATCCTCGAGGATAACCATGGCGAACGGAACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000317392    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007633.2-371s21c1
Sequence:CCGGCCTGGGATGATAATTCAGCATCTCGAGATGCTGAATTATCATCCCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000317460    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007633.2-1325s21c1
Sequence:CCGGCCATATTGTCAGAACAGAATACTCGAGTATTCTGTTCTGACAATATGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000317461    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007633.2-1766s21c1
Sequence:CCGGCGGGTGTTGTAGGTTGCTGTTCTCGAGAACAGCAACCTACAACACCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_007633
VALIDATED
CCNE1 MISSION shRNA Lentiviral Transduction Particles
cyclin E1
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000077774    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007633.1-261s1c1
Sequence:CCGGCCTAACAAAGAAGAGGACAATCTCGAGATTGTCCTCTTCTTTGTTAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000077776    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007633.1-1165s1c1
Sequence:CCGGCCATATTGTCAGAACAGAATACTCGAGTATTCTGTTCTGACAATATGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000077777    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007633.1-211s1c1
Sequence:CCGGCCTGGGATGATAATTCAGCATCTCGAGATGCTGAATTATCATCCCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000077775    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007633.1-564s1c1
Sequence:CCGGGCATCACAACAGAATATCATACTCGAGTATGATATTCTGTTGTGATGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000222722    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007633.1-1607s1c2
Sequence:CCGGCGGGTGTTGTAGGTTGCTGTTCTCGAGAACAGCAACCTACAACACCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000313875    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007633.2-718s21c1
Sequence:CCGGTACATGGCATCACAACATAATCTCGAGATTATGTTGTGATGCCATGTATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000313874    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007633.2-1186s21c1
Sequence:CCGGGTTCCGTTCGCCATGGTTATCCTCGAGGATAACCATGGCGAACGGAACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000317392    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007633.2-371s21c1
Sequence:CCGGCCTGGGATGATAATTCAGCATCTCGAGATGCTGAATTATCATCCCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000317460    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007633.2-1325s21c1
Sequence:CCGGCCATATTGTCAGAACAGAATACTCGAGTATTCTGTTCTGACAATATGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000317461    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007633.2-1766s21c1
Sequence:CCGGCGGGTGTTGTAGGTTGCTGTTCTCGAGAACAGCAACCTACAACACCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001238
CCNE1 MISSION shRNA Bacterial Glycerol Stock
cyclin E1
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000045299    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001238.1-1302s1c1
Sequence:CCGGCCGAGCAAAGAAAGCCATGTTCTCGAGAACATGGCTTTCTTTGCTCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000045302    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001238.1-1149s1c1
Sequence:CCGGCGACATAGAGAACTGTGTCAACTCGAGTTGACACAGTTCTCTATGTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000045301    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001238.1-619s1c1
Sequence:CCGGGCAATTCTTCTGGATTGGTTACTCGAGTAACCAATCCAGAAGAATTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000045300    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001238.1-1091s1c1
Sequence:CCGGCCTTGTATCATTTCTCGTCATCTCGAGATGACGAGAAATGATACAAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000428513    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001238.1-693s21c1
Sequence:CCGGAGATTTCTTTGACCGGTATATCTCGAGATATACCGGTCAAAGAAATCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000420972    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001238.1-643s21c1
Sequence:CCGGGAGGTGTGTGAAGTCTATAAACTCGAGTTTATAGACTTCACACACCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000413480    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001238.1-454s21c1
Sequence:CCGGACGTGCAAGCCTCGGATTATTCTCGAGAATAATCCGAGGCTTGCACGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001238
CCNE1 MISSION shRNA shRNA Plasmid DNA
cyclin E1
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000045299    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001238.1-1302s1c1
Sequence:CCGGCCGAGCAAAGAAAGCCATGTTCTCGAGAACATGGCTTTCTTTGCTCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000045302    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001238.1-1149s1c1
Sequence:CCGGCGACATAGAGAACTGTGTCAACTCGAGTTGACACAGTTCTCTATGTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000045301    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001238.1-619s1c1
Sequence:CCGGGCAATTCTTCTGGATTGGTTACTCGAGTAACCAATCCAGAAGAATTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000045300    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001238.1-1091s1c1
Sequence:CCGGCCTTGTATCATTTCTCGTCATCTCGAGATGACGAGAAATGATACAAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000428513    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001238.1-693s21c1
Sequence:CCGGAGATTTCTTTGACCGGTATATCTCGAGATATACCGGTCAAAGAAATCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000420972    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001238.1-643s21c1
Sequence:CCGGGAGGTGTGTGAAGTCTATAAACTCGAGTTTATAGACTTCACACACCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000413480    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001238.1-454s21c1
Sequence:CCGGACGTGCAAGCCTCGGATTATTCTCGAGAATAATCCGAGGCTTGCACGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001238
CCNE1 MISSION shRNA Lentiviral Transduction Particles
cyclin E1
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000045299    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001238.1-1302s1c1
Sequence:CCGGCCGAGCAAAGAAAGCCATGTTCTCGAGAACATGGCTTTCTTTGCTCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000045302    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001238.1-1149s1c1
Sequence:CCGGCGACATAGAGAACTGTGTCAACTCGAGTTGACACAGTTCTCTATGTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000045301    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001238.1-619s1c1
Sequence:CCGGGCAATTCTTCTGGATTGGTTACTCGAGTAACCAATCCAGAAGAATTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000045300    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001238.1-1091s1c1
Sequence:CCGGCCTTGTATCATTTCTCGTCATCTCGAGATGACGAGAAATGATACAAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000428513    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001238.1-693s21c1
Sequence:CCGGAGATTTCTTTGACCGGTATATCTCGAGATATACCGGTCAAAGAAATCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000420972    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001238.1-643s21c1
Sequence:CCGGGAGGTGTGTGAAGTCTATAAACTCGAGTTTATAGACTTCACACACCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000413480    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001238.1-454s21c1
Sequence:CCGGACGTGCAAGCCTCGGATTATTCTCGAGAATAATCCGAGGCTTGCACGTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)